Incidental Mutation 'R4755:Cdk5rap2'
ID 357886
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 042033-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R4755 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70156662 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1617 (S1617P)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124251
Predicted Effect probably damaging
Transcript: ENSMUST00000138561
AA Change: S366P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298
AA Change: S366P

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144099
AA Change: S1617P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: S1617P

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,733,280 (GRCm39) noncoding transcript Het
Aadacl2fm1 C T 3: 59,843,735 (GRCm39) A143V probably benign Het
Accs T C 2: 93,671,682 (GRCm39) E236G probably damaging Het
Agrn C T 4: 156,257,979 (GRCm39) probably benign Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Akap5 C A 12: 76,374,581 (GRCm39) C4* probably null Het
Amotl2 A T 9: 102,597,679 (GRCm39) H146L probably damaging Het
Ank1 A G 8: 23,594,990 (GRCm39) N666S probably damaging Het
Atp10d A T 5: 72,403,509 (GRCm39) T373S probably benign Het
Bpifb9b T A 2: 154,161,614 (GRCm39) M582K probably benign Het
Brca2 T A 5: 150,483,452 (GRCm39) probably null Het
Ccdc149 A G 5: 52,561,493 (GRCm39) V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cenpk A T 13: 104,367,379 (GRCm39) M37L probably benign Het
Cenpk A T 13: 104,386,020 (GRCm39) H305L probably benign Het
Ces5a C A 8: 94,262,305 (GRCm39) A11S probably benign Het
Cfap65 T C 1: 74,967,520 (GRCm39) E186G probably damaging Het
Cfh T A 1: 140,016,546 (GRCm39) I593F probably damaging Het
Clstn2 C T 9: 97,327,726 (GRCm39) V961I probably benign Het
Cog5 T A 12: 31,919,405 (GRCm39) probably null Het
Col4a4 T C 1: 82,518,895 (GRCm39) D100G unknown Het
Cyp3a41a T C 5: 145,652,316 (GRCm39) D61G probably damaging Het
Dnah10 A G 5: 124,824,809 (GRCm39) N655S probably benign Het
Dnai1 C G 4: 41,610,269 (GRCm39) T295R probably damaging Het
Dnajc6 C T 4: 101,407,996 (GRCm39) A44V probably damaging Het
Eif4enif1 A T 11: 3,194,016 (GRCm39) D960V probably damaging Het
Fam167b C T 4: 129,472,135 (GRCm39) G12R probably damaging Het
Fam20b A T 1: 156,515,066 (GRCm39) Y266* probably null Het
Fer1l6 T A 15: 58,512,060 (GRCm39) V1509D probably benign Het
Fhad1 A T 4: 141,655,794 (GRCm39) I105N probably damaging Het
Fmo2 T C 1: 162,716,374 (GRCm39) D71G probably damaging Het
Folr2 T C 7: 101,493,006 (GRCm39) T6A possibly damaging Het
Fry A C 5: 150,321,719 (GRCm39) E1018A probably damaging Het
Gas2l2 A G 11: 83,320,193 (GRCm39) I21T probably damaging Het
Gfra1 T C 19: 58,441,676 (GRCm39) Y85C probably damaging Het
Gpld1 A T 13: 25,163,671 (GRCm39) Y43F probably benign Het
Gpld1 T A 13: 25,163,675 (GRCm39) Y44* probably null Het
Grid2 A G 6: 63,885,972 (GRCm39) T123A probably benign Het
Grina T C 15: 76,133,442 (GRCm39) L305P probably damaging Het
Gucy1a1 G A 3: 82,002,102 (GRCm39) A659V probably benign Het
H2-T10 T A 17: 36,429,837 (GRCm39) K319* probably null Het
Hey2 A T 10: 30,710,300 (GRCm39) V151E probably benign Het
Ighv1-69 G A 12: 115,587,178 (GRCm39) T13I probably benign Het
Il1rap C A 16: 26,541,532 (GRCm39) A591E probably benign Het
Ildr1 T C 16: 36,542,383 (GRCm39) L261P probably benign Het
Jak1 A G 4: 101,031,354 (GRCm39) Y463H probably damaging Het
Lrp1b T C 2: 41,159,285 (GRCm39) I1666V probably benign Het
Lrp1b T A 2: 41,361,028 (GRCm39) T592S probably benign Het
Lrrc36 A G 8: 106,178,776 (GRCm39) T445A possibly damaging Het
Ly9 G A 1: 171,434,806 (GRCm39) S29F probably damaging Het
Mapk7 A C 11: 61,381,669 (GRCm39) C32W probably damaging Het
Marchf10 C T 11: 105,255,302 (GRCm39) probably benign Het
Mier2 A T 10: 79,385,031 (GRCm39) M119K probably damaging Het
Mpv17 A T 5: 31,303,326 (GRCm39) C59* probably null Het
Mrpl27 G A 11: 94,544,659 (GRCm39) probably benign Het
Myo18b G A 5: 113,022,340 (GRCm39) Q351* probably null Het
Myo1a A G 10: 127,551,557 (GRCm39) I704M probably damaging Het
Nadsyn1 A G 7: 143,360,650 (GRCm39) C373R probably damaging Het
Nckipsd C A 9: 108,691,938 (GRCm39) A513E probably benign Het
Neb T C 2: 52,110,221 (GRCm39) D209G probably damaging Het
Nkapl T A 13: 21,652,457 (GRCm39) Q52L unknown Het
Nptx2 G A 5: 144,483,250 (GRCm39) S126N probably benign Het
Or2a7 G A 6: 43,150,977 (GRCm39) S19N probably benign Het
Or52d3 T A 7: 104,229,268 (GRCm39) Y138* probably null Het
Or7g17 A T 9: 18,768,476 (GRCm39) H185L probably benign Het
Or8b52 A G 9: 38,577,128 (GRCm39) V4A probably benign Het
Pclo A T 5: 14,764,362 (GRCm39) R4278S unknown Het
Pcnx1 T G 12: 81,997,068 (GRCm39) L988R probably damaging Het
Prl2c5 C A 13: 13,363,970 (GRCm39) N75K probably benign Het
Prpf19 T G 19: 10,875,154 (GRCm39) probably benign Het
Ralgapa1 A G 12: 55,759,533 (GRCm39) S997P probably damaging Het
Rangap1 T C 15: 81,597,118 (GRCm39) T226A probably benign Het
Rimklb G A 6: 122,433,365 (GRCm39) L262F probably damaging Het
Rnf169 A G 7: 99,574,930 (GRCm39) M555T probably benign Het
Rp1l1 A T 14: 64,267,519 (GRCm39) D1035V probably benign Het
Rps23rg1 A T 8: 3,633,922 (GRCm39) S8C probably damaging Het
Scd2 T A 19: 44,289,791 (GRCm39) L262Q probably damaging Het
Scgb2b12 T A 7: 32,024,956 (GRCm39) M84L probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 G A 12: 82,419,160 (GRCm39) V613I possibly damaging Het
Slc25a23 T A 17: 57,359,794 (GRCm39) D67V possibly damaging Het
Slc25a39 C T 11: 102,297,492 (GRCm39) probably benign Het
Slc4a10 T A 2: 62,127,332 (GRCm39) F895Y probably damaging Het
Slc5a4a A C 10: 76,022,398 (GRCm39) K578Q probably benign Het
Slc6a13 G A 6: 121,302,008 (GRCm39) G197S probably damaging Het
Smarca2 A T 19: 26,631,883 (GRCm39) E566V possibly damaging Het
Sorbs3 A T 14: 70,421,548 (GRCm39) N594K probably benign Het
Spata22 A T 11: 73,236,582 (GRCm39) D296V probably damaging Het
Sphk2 G A 7: 45,363,058 (GRCm39) A11V possibly damaging Het
Spp1 A T 5: 104,583,081 (GRCm39) probably benign Het
Strn3 T A 12: 51,656,999 (GRCm39) I760L possibly damaging Het
Syk A T 13: 52,796,022 (GRCm39) Y539F probably benign Het
Tdpoz9-ps1 T C 3: 93,846,093 (GRCm39) probably null Het
Thsd7b T A 1: 130,138,001 (GRCm39) Y1560N probably benign Het
Tmod2 C A 9: 75,504,494 (GRCm39) E42* probably null Het
Tom1l1 T C 11: 90,575,942 (GRCm39) E30G probably damaging Het
Trav10 G A 14: 53,743,518 (GRCm39) A40T probably benign Het
Trav14-2 G A 14: 53,878,237 (GRCm39) probably benign Het
Tril T A 6: 53,795,449 (GRCm39) E591V probably damaging Het
Trp53bp1 T A 2: 121,059,087 (GRCm39) R179* probably null Het
Tspoap1 A T 11: 87,662,489 (GRCm39) D562V possibly damaging Het
Usp44 A T 10: 93,682,768 (GRCm39) H406L probably damaging Het
Vangl1 A G 3: 102,065,608 (GRCm39) I509T probably benign Het
Vax2 T G 6: 83,688,379 (GRCm39) L34W probably damaging Het
Vmn1r55 A T 7: 5,150,025 (GRCm39) C133S probably damaging Het
Vmn2r8 T A 5: 108,949,566 (GRCm39) D427V probably benign Het
Vwde A G 6: 13,205,851 (GRCm39) I232T possibly damaging Het
Wnk1 C A 6: 119,940,431 (GRCm39) A769S probably damaging Het
Xpo4 A C 14: 57,855,638 (GRCm39) S264A probably benign Het
Zfp330 A T 8: 83,496,015 (GRCm39) C75* probably null Het
Zfp526 T A 7: 24,925,064 (GRCm39) L441Q probably benign Het
Zfp607b T G 7: 27,402,930 (GRCm39) L462R probably damaging Het
Zfp719 T A 7: 43,240,217 (GRCm39) F602I probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCCAGCTGATCTGCTTATAGAG -3'
(R):5'- GGTGACAGCATGGCTCATATTG -3'

Sequencing Primer
(F):5'- CTGCTTATAGAGGGCATCATAGTCC -3'
(R):5'- CAGCATGGCTCATATTGGCAGTC -3'
Posted On 2015-11-11