Incidental Mutation 'R4755:Ank1'
ID357922
Institutional Source Beutler Lab
Gene Symbol Ank1
Ensembl Gene ENSMUSG00000031543
Gene Nameankyrin 1, erythroid
SynonymsAnk-1, pale
MMRRC Submission 042033-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R4755 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22974844-23150497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23104974 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 666 (N666S)
Ref Sequence ENSEMBL: ENSMUSP00000133322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084038] [ENSMUST00000110688] [ENSMUST00000117270] [ENSMUST00000117296] [ENSMUST00000117662] [ENSMUST00000118733] [ENSMUST00000121802] [ENSMUST00000123418] [ENSMUST00000141784] [ENSMUST00000152511] [ENSMUST00000173248] [ENSMUST00000173573]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084038
AA Change: N666S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081051
Gene: ENSMUSG00000031543
AA Change: N666S

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110688
AA Change: N695S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106316
Gene: ENSMUSG00000031543
AA Change: N695S

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 944 1048 1.9e-60 SMART
low complexity region 1071 1080 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
DEATH 1426 1520 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117270
AA Change: N695S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113495
Gene: ENSMUSG00000031543
AA Change: N695S

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117296
AA Change: N658S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113656
Gene: ENSMUSG00000031543
AA Change: N658S

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117662
AA Change: N658S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113531
Gene: ENSMUSG00000031543
AA Change: N658S

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118733
AA Change: N666S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112850
Gene: ENSMUSG00000031543
AA Change: N666S

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121802
AA Change: N695S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113571
Gene: ENSMUSG00000031543
AA Change: N695S

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123418
SMART Domains Protein: ENSMUSP00000121785
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141784
AA Change: N658S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117966
Gene: ENSMUSG00000031543
AA Change: N658S

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152511
AA Change: N259S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116533
Gene: ENSMUSG00000031543
AA Change: N259S

DomainStartEndE-ValueType
ANK 1 29 4.82e-3 SMART
ANK 33 62 7.53e-5 SMART
ANK 66 95 5.49e-7 SMART
ANK 99 128 2.58e-3 SMART
ANK 132 161 1.88e-5 SMART
ANK 165 194 1.02e-6 SMART
ANK 198 227 7.64e-6 SMART
ANK 231 262 3.23e-4 SMART
ANK 264 293 1.38e-3 SMART
ANK 297 326 1.58e-7 SMART
ANK 330 359 2.85e-5 SMART
ZU5 508 612 1.9e-60 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
DEATH 990 1090 4.31e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173248
AA Change: N666S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133322
Gene: ENSMUSG00000031543
AA Change: N666S

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173573
AA Change: N666S

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133901
Gene: ENSMUSG00000031543
AA Change: N666S

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197671
Meta Mutation Damage Score 0.1266 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutant animals are anemic, infertile, and have reduced body size. Mutant animals also exhibit jaundice, bone marrow hyperplasia, splenomegaly, hepatomegaly, enlarged lymph nodes, increased white blood cell count, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,859 noncoding transcript Het
Accs T C 2: 93,841,337 E236G probably damaging Het
Agrn C T 4: 156,173,522 probably benign Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Akap5 C A 12: 76,327,807 C4* probably null Het
Amotl2 A T 9: 102,720,480 H146L probably damaging Het
Atp10d A T 5: 72,246,166 T373S probably benign Het
Bpifb9b T A 2: 154,319,694 M582K probably benign Het
Brca2 T A 5: 150,559,987 probably null Het
C130079G13Rik C T 3: 59,936,314 A143V probably benign Het
C330021F23Rik A T 8: 3,583,922 S8C probably damaging Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdk5rap2 A G 4: 70,238,425 S1617P probably damaging Het
Cenpk A T 13: 104,230,871 M37L probably benign Het
Cenpk A T 13: 104,249,512 H305L probably benign Het
Ces5a C A 8: 93,535,677 A11S probably benign Het
Cfap65 T C 1: 74,928,361 E186G probably damaging Het
Cfh T A 1: 140,088,808 I593F probably damaging Het
Clstn2 C T 9: 97,445,673 V961I probably benign Het
Cog5 T A 12: 31,869,406 probably null Het
Col4a4 T C 1: 82,541,174 D100G unknown Het
Cyp3a41a T C 5: 145,715,506 D61G probably damaging Het
Dnah10 A G 5: 124,747,745 N655S probably benign Het
Dnaic1 C G 4: 41,610,269 T295R probably damaging Het
Dnajc6 C T 4: 101,550,799 A44V probably damaging Het
Eif4enif1 A T 11: 3,244,016 D960V probably damaging Het
Fam167b C T 4: 129,578,342 G12R probably damaging Het
Fam20b A T 1: 156,687,496 Y266* probably null Het
Fer1l6 T A 15: 58,640,211 V1509D probably benign Het
Fhad1 A T 4: 141,928,483 I105N probably damaging Het
Fmo2 T C 1: 162,888,805 D71G probably damaging Het
Folr2 T C 7: 101,843,799 T6A possibly damaging Het
Fry A C 5: 150,398,254 E1018A probably damaging Het
Gas2l2 A G 11: 83,429,367 I21T probably damaging Het
Gfra1 T C 19: 58,453,244 Y85C probably damaging Het
Gm9117 T C 3: 93,938,786 probably null Het
Gpld1 A T 13: 24,979,688 Y43F probably benign Het
Gpld1 T A 13: 24,979,692 Y44* probably null Het
Grid2 A G 6: 63,908,988 T123A probably benign Het
Grina T C 15: 76,249,242 L305P probably damaging Het
Gucy1a1 G A 3: 82,094,795 A659V probably benign Het
H2-T10 T A 17: 36,118,945 K319* probably null Het
Hey2 A T 10: 30,834,304 V151E probably benign Het
Ighv1-69 G A 12: 115,623,558 T13I probably benign Het
Il1rap C A 16: 26,722,782 A591E probably benign Het
Ildr1 T C 16: 36,722,021 L261P probably benign Het
Jak1 A G 4: 101,174,157 Y463H probably damaging Het
Lrp1b T C 2: 41,269,273 I1666V probably benign Het
Lrp1b T A 2: 41,471,016 T592S probably benign Het
Lrrc36 A G 8: 105,452,144 T445A possibly damaging Het
Ly9 G A 1: 171,607,238 S29F probably damaging Het
Mapk7 A C 11: 61,490,843 C32W probably damaging Het
March10 C T 11: 105,364,476 probably benign Het
Mier2 A T 10: 79,549,197 M119K probably damaging Het
Mpv17 A T 5: 31,145,982 C59* probably null Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Myo18b G A 5: 112,874,474 Q351* probably null Het
Myo1a A G 10: 127,715,688 I704M probably damaging Het
Nadsyn1 A G 7: 143,806,913 C373R probably damaging Het
Nckipsd C A 9: 108,814,739 A513E probably benign Het
Neb T C 2: 52,220,209 D209G probably damaging Het
Nkapl T A 13: 21,468,287 Q52L unknown Het
Nptx2 G A 5: 144,546,440 S126N probably benign Het
Olfr13 G A 6: 43,174,043 S19N probably benign Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Olfr829 A T 9: 18,857,180 H185L probably benign Het
Olfr917 A G 9: 38,665,832 V4A probably benign Het
Pclo A T 5: 14,714,348 R4278S unknown Het
Pcnx T G 12: 81,950,294 L988R probably damaging Het
Prl2c5 C A 13: 13,189,385 N75K probably benign Het
Prpf19 T G 19: 10,897,790 probably benign Het
Ralgapa1 A G 12: 55,712,748 S997P probably damaging Het
Rangap1 T C 15: 81,712,917 T226A probably benign Het
Rimklb G A 6: 122,456,406 L262F probably damaging Het
Rnf169 A G 7: 99,925,723 M555T probably benign Het
Rp1l1 A T 14: 64,030,070 D1035V probably benign Het
Scd2 T A 19: 44,301,352 L262Q probably damaging Het
Scgb2b12 T A 7: 32,325,531 M84L probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G A 12: 82,372,386 V613I possibly damaging Het
Slc25a23 T A 17: 57,052,794 D67V possibly damaging Het
Slc25a39 C T 11: 102,406,666 probably benign Het
Slc4a10 T A 2: 62,296,988 F895Y probably damaging Het
Slc5a4a A C 10: 76,186,564 K578Q probably benign Het
Slc6a13 G A 6: 121,325,049 G197S probably damaging Het
Smarca2 A T 19: 26,654,483 E566V possibly damaging Het
Sorbs3 A T 14: 70,184,099 N594K probably benign Het
Spata22 A T 11: 73,345,756 D296V probably damaging Het
Sphk2 G A 7: 45,713,634 A11V possibly damaging Het
Spp1 A T 5: 104,435,215 probably benign Het
Strn3 T A 12: 51,610,216 I760L possibly damaging Het
Syk A T 13: 52,641,986 Y539F probably benign Het
Thsd7b T A 1: 130,210,264 Y1560N probably benign Het
Tmod2 C A 9: 75,597,212 E42* probably null Het
Tom1l1 T C 11: 90,685,116 E30G probably damaging Het
Trav10 G A 14: 53,506,061 A40T probably benign Het
Trav14-2 G A 14: 53,640,780 probably benign Het
Tril T A 6: 53,818,464 E591V probably damaging Het
Trp53bp1 T A 2: 121,228,606 R179* probably null Het
Tspoap1 A T 11: 87,771,663 D562V possibly damaging Het
Usp44 A T 10: 93,846,906 H406L probably damaging Het
Vangl1 A G 3: 102,158,292 I509T probably benign Het
Vax2 T G 6: 83,711,397 L34W probably damaging Het
Vmn1r55 A T 7: 5,147,026 C133S probably damaging Het
Vmn2r8 T A 5: 108,801,700 D427V probably benign Het
Vwde A G 6: 13,205,852 I232T possibly damaging Het
Wnk1 C A 6: 119,963,470 A769S probably damaging Het
Xpo4 A C 14: 57,618,181 S264A probably benign Het
Zfp330 A T 8: 82,769,386 C75* probably null Het
Zfp526 T A 7: 25,225,639 L441Q probably benign Het
Zfp607b T G 7: 27,703,505 L462R probably damaging Het
Zfp719 T A 7: 43,590,793 F602I probably damaging Het
Other mutations in Ank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Ank1 APN 8 23141644 missense probably damaging 1.00
IGL01099:Ank1 APN 8 23108249 missense probably damaging 0.97
IGL01586:Ank1 APN 8 23120912 missense probably benign
IGL01866:Ank1 APN 8 23093855 missense possibly damaging 0.88
IGL01977:Ank1 APN 8 23115433 missense probably benign 0.01
IGL02109:Ank1 APN 8 23096184 missense probably damaging 1.00
IGL02182:Ank1 APN 8 23113852 missense possibly damaging 0.89
IGL02261:Ank1 APN 8 23087999 missense probably damaging 1.00
IGL02283:Ank1 APN 8 23119434 critical splice donor site probably null
IGL02335:Ank1 APN 8 23135638 missense possibly damaging 0.86
IGL02933:Ank1 APN 8 23122865 missense possibly damaging 0.52
IGL03056:Ank1 APN 8 23141179 missense probably damaging 1.00
IGL03089:Ank1 APN 8 23104832 missense probably benign 0.00
IGL03257:Ank1 APN 8 23122898 missense probably damaging 1.00
IGL03389:Ank1 APN 8 23088060 critical splice donor site probably null
Hema6 UTSW 8 23097638 intron probably benign
BB006:Ank1 UTSW 8 23116107 missense probably damaging 1.00
BB016:Ank1 UTSW 8 23116107 missense probably damaging 1.00
R0030:Ank1 UTSW 8 23093893 missense probably damaging 1.00
R0077:Ank1 UTSW 8 23140167 missense probably damaging 1.00
R0081:Ank1 UTSW 8 23116242 missense possibly damaging 0.95
R0147:Ank1 UTSW 8 23123977 missense probably damaging 1.00
R0148:Ank1 UTSW 8 23123977 missense probably damaging 1.00
R0200:Ank1 UTSW 8 23096812 missense probably damaging 1.00
R0270:Ank1 UTSW 8 23088925 splice site probably benign
R0309:Ank1 UTSW 8 23104809 missense probably damaging 1.00
R0490:Ank1 UTSW 8 23107874 splice site probably benign
R0675:Ank1 UTSW 8 23110384 splice site probably benign
R0738:Ank1 UTSW 8 23114114 missense probably damaging 0.98
R1051:Ank1 UTSW 8 23093940 missense probably damaging 1.00
R1239:Ank1 UTSW 8 23096155 missense probably damaging 1.00
R1265:Ank1 UTSW 8 23117037 missense possibly damaging 0.64
R1367:Ank1 UTSW 8 23111803 splice site probably benign
R1413:Ank1 UTSW 8 23119377 missense probably damaging 1.00
R1539:Ank1 UTSW 8 23093919 missense probably damaging 1.00
R1682:Ank1 UTSW 8 23109327 missense probably damaging 1.00
R1732:Ank1 UTSW 8 23111463 splice site probably benign
R1911:Ank1 UTSW 8 23099650 missense probably damaging 1.00
R2087:Ank1 UTSW 8 23093811 missense probably damaging 1.00
R2184:Ank1 UTSW 8 23109254 missense probably damaging 0.98
R2302:Ank1 UTSW 8 23119399 missense probably damaging 1.00
R2356:Ank1 UTSW 8 23085672 missense probably damaging 1.00
R2495:Ank1 UTSW 8 23132264 missense probably damaging 1.00
R3000:Ank1 UTSW 8 23119431 missense probably damaging 1.00
R3113:Ank1 UTSW 8 23084797 missense probably damaging 1.00
R3710:Ank1 UTSW 8 23087079 missense probably damaging 1.00
R3768:Ank1 UTSW 8 23116186 missense possibly damaging 0.92
R3771:Ank1 UTSW 8 23123897 missense probably benign 0.03
R4002:Ank1 UTSW 8 23139463 missense probably damaging 0.98
R4478:Ank1 UTSW 8 23120578 missense probably benign 0.30
R4756:Ank1 UTSW 8 23122877 missense probably benign
R4979:Ank1 UTSW 8 23132196 missense probably damaging 0.98
R4989:Ank1 UTSW 8 23141118 intron probably benign
R5011:Ank1 UTSW 8 23082284 missense probably damaging 1.00
R5013:Ank1 UTSW 8 23082284 missense probably damaging 1.00
R5031:Ank1 UTSW 8 23099680 missense probably damaging 1.00
R5051:Ank1 UTSW 8 23119381 missense probably damaging 1.00
R5059:Ank1 UTSW 8 23096188 missense probably damaging 0.99
R5086:Ank1 UTSW 8 23088618 missense probably damaging 1.00
R5108:Ank1 UTSW 8 23132555 missense probably benign 0.11
R5235:Ank1 UTSW 8 23082196 missense probably damaging 1.00
R5300:Ank1 UTSW 8 23132501 missense probably benign 0.00
R5408:Ank1 UTSW 8 23082193 missense probably damaging 1.00
R5537:Ank1 UTSW 8 23114876 missense probably damaging 1.00
R5728:Ank1 UTSW 8 23122767 critical splice acceptor site probably null
R5746:Ank1 UTSW 8 23116596 missense probably damaging 1.00
R5837:Ank1 UTSW 8 23104790 missense probably damaging 0.99
R5907:Ank1 UTSW 8 23140204 missense probably damaging 1.00
R5997:Ank1 UTSW 8 23099662 missense probably damaging 1.00
R6005:Ank1 UTSW 8 23132202 missense probably damaging 1.00
R6046:Ank1 UTSW 8 23116098 missense probably damaging 1.00
R6103:Ank1 UTSW 8 23113983 missense probably damaging 1.00
R6268:Ank1 UTSW 8 23109671 missense probably damaging 1.00
R6430:Ank1 UTSW 8 23132109 missense probably damaging 1.00
R6457:Ank1 UTSW 8 23087967 missense probably damaging 1.00
R6626:Ank1 UTSW 8 22975191 missense probably damaging 0.98
R6935:Ank1 UTSW 8 23108231 missense probably damaging 1.00
R7091:Ank1 UTSW 8 23058663 missense probably benign
R7162:Ank1 UTSW 8 23132354 missense possibly damaging 0.94
R7475:Ank1 UTSW 8 23132630 missense probably benign
R7546:Ank1 UTSW 8 23064995 missense probably damaging 1.00
R7678:Ank1 UTSW 8 23117058 missense probably damaging 0.98
R7768:Ank1 UTSW 8 23097997 missense probably benign 0.01
R7779:Ank1 UTSW 8 23096747 critical splice acceptor site probably null
R7864:Ank1 UTSW 8 23087960 missense probably damaging 1.00
R7929:Ank1 UTSW 8 23116107 missense probably damaging 1.00
R7982:Ank1 UTSW 8 23119381 missense probably damaging 1.00
R7984:Ank1 UTSW 8 23088966 missense probably damaging 1.00
R8273:Ank1 UTSW 8 23085652 missense probably damaging 1.00
R8318:Ank1 UTSW 8 23115551 missense probably damaging 0.99
R8349:Ank1 UTSW 8 23139286 missense possibly damaging 0.66
R8449:Ank1 UTSW 8 23139286 missense possibly damaging 0.66
R8459:Ank1 UTSW 8 23115512 missense probably damaging 1.00
R8506:Ank1 UTSW 8 23096835 missense probably damaging 1.00
R8889:Ank1 UTSW 8 23116974 missense probably damaging 1.00
R8893:Ank1 UTSW 8 23108225 missense probably damaging 1.00
RF024:Ank1 UTSW 8 23119344 missense probably benign 0.37
X0066:Ank1 UTSW 8 23141584 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGGCTACACTCCTTTGCAC -3'
(R):5'- TCATCAGATTTCTCACTGGGAC -3'

Sequencing Primer
(F):5'- TTGCACATCGCTGCCAAG -3'
(R):5'- TATCACAGAGAAAGGAGCCTCTCTTG -3'
Posted On2015-11-11