Incidental Mutation 'R4755:Ahi1'
ID357931
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene NameAbelson helper integration site 1
Synonyms1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1
MMRRC Submission 042033-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R4755 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location20952547-21080429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21055047 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 929 (I929V)
Ref Sequence ENSEMBL: ENSMUSP00000149010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000163505] [ENSMUST00000213104]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105525
AA Change: I929V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: I929V

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163505
AA Change: I24V

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127043
Gene: ENSMUSG00000019986
AA Change: I24V

DomainStartEndE-ValueType
SH3 1 56 2.36e-18 SMART
low complexity region 70 84 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213104
AA Change: I929V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214893
Meta Mutation Damage Score 0.1331 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,859 noncoding transcript Het
Accs T C 2: 93,841,337 E236G probably damaging Het
Agrn C T 4: 156,173,522 probably benign Het
Akap5 C A 12: 76,327,807 C4* probably null Het
Amotl2 A T 9: 102,720,480 H146L probably damaging Het
Ank1 A G 8: 23,104,974 N666S probably damaging Het
Atp10d A T 5: 72,246,166 T373S probably benign Het
Bpifb9b T A 2: 154,319,694 M582K probably benign Het
Brca2 T A 5: 150,559,987 probably null Het
C130079G13Rik C T 3: 59,936,314 A143V probably benign Het
C330021F23Rik A T 8: 3,583,922 S8C probably damaging Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdk5rap2 A G 4: 70,238,425 S1617P probably damaging Het
Cenpk A T 13: 104,230,871 M37L probably benign Het
Cenpk A T 13: 104,249,512 H305L probably benign Het
Ces5a C A 8: 93,535,677 A11S probably benign Het
Cfap65 T C 1: 74,928,361 E186G probably damaging Het
Cfh T A 1: 140,088,808 I593F probably damaging Het
Clstn2 C T 9: 97,445,673 V961I probably benign Het
Cog5 T A 12: 31,869,406 probably null Het
Col4a4 T C 1: 82,541,174 D100G unknown Het
Cyp3a41a T C 5: 145,715,506 D61G probably damaging Het
Dnah10 A G 5: 124,747,745 N655S probably benign Het
Dnaic1 C G 4: 41,610,269 T295R probably damaging Het
Dnajc6 C T 4: 101,550,799 A44V probably damaging Het
Eif4enif1 A T 11: 3,244,016 D960V probably damaging Het
Fam167b C T 4: 129,578,342 G12R probably damaging Het
Fam20b A T 1: 156,687,496 Y266* probably null Het
Fer1l6 T A 15: 58,640,211 V1509D probably benign Het
Fhad1 A T 4: 141,928,483 I105N probably damaging Het
Fmo2 T C 1: 162,888,805 D71G probably damaging Het
Folr2 T C 7: 101,843,799 T6A possibly damaging Het
Fry A C 5: 150,398,254 E1018A probably damaging Het
Gas2l2 A G 11: 83,429,367 I21T probably damaging Het
Gfra1 T C 19: 58,453,244 Y85C probably damaging Het
Gm9117 T C 3: 93,938,786 probably null Het
Gpld1 T A 13: 24,979,692 Y44* probably null Het
Gpld1 A T 13: 24,979,688 Y43F probably benign Het
Grid2 A G 6: 63,908,988 T123A probably benign Het
Grina T C 15: 76,249,242 L305P probably damaging Het
Gucy1a1 G A 3: 82,094,795 A659V probably benign Het
H2-T10 T A 17: 36,118,945 K319* probably null Het
Hey2 A T 10: 30,834,304 V151E probably benign Het
Ighv1-69 G A 12: 115,623,558 T13I probably benign Het
Il1rap C A 16: 26,722,782 A591E probably benign Het
Ildr1 T C 16: 36,722,021 L261P probably benign Het
Jak1 A G 4: 101,174,157 Y463H probably damaging Het
Lrp1b T C 2: 41,269,273 I1666V probably benign Het
Lrp1b T A 2: 41,471,016 T592S probably benign Het
Lrrc36 A G 8: 105,452,144 T445A possibly damaging Het
Ly9 G A 1: 171,607,238 S29F probably damaging Het
Mapk7 A C 11: 61,490,843 C32W probably damaging Het
March10 C T 11: 105,364,476 probably benign Het
Mier2 A T 10: 79,549,197 M119K probably damaging Het
Mpv17 A T 5: 31,145,982 C59* probably null Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Myo18b G A 5: 112,874,474 Q351* probably null Het
Myo1a A G 10: 127,715,688 I704M probably damaging Het
Nadsyn1 A G 7: 143,806,913 C373R probably damaging Het
Nckipsd C A 9: 108,814,739 A513E probably benign Het
Neb T C 2: 52,220,209 D209G probably damaging Het
Nkapl T A 13: 21,468,287 Q52L unknown Het
Nptx2 G A 5: 144,546,440 S126N probably benign Het
Olfr13 G A 6: 43,174,043 S19N probably benign Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Olfr829 A T 9: 18,857,180 H185L probably benign Het
Olfr917 A G 9: 38,665,832 V4A probably benign Het
Pclo A T 5: 14,714,348 R4278S unknown Het
Pcnx T G 12: 81,950,294 L988R probably damaging Het
Prl2c5 C A 13: 13,189,385 N75K probably benign Het
Prpf19 T G 19: 10,897,790 probably benign Het
Ralgapa1 A G 12: 55,712,748 S997P probably damaging Het
Rangap1 T C 15: 81,712,917 T226A probably benign Het
Rimklb G A 6: 122,456,406 L262F probably damaging Het
Rnf169 A G 7: 99,925,723 M555T probably benign Het
Rp1l1 A T 14: 64,030,070 D1035V probably benign Het
Scd2 T A 19: 44,301,352 L262Q probably damaging Het
Scgb2b12 T A 7: 32,325,531 M84L probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G A 12: 82,372,386 V613I possibly damaging Het
Slc25a23 T A 17: 57,052,794 D67V possibly damaging Het
Slc25a39 C T 11: 102,406,666 probably benign Het
Slc4a10 T A 2: 62,296,988 F895Y probably damaging Het
Slc5a4a A C 10: 76,186,564 K578Q probably benign Het
Slc6a13 G A 6: 121,325,049 G197S probably damaging Het
Smarca2 A T 19: 26,654,483 E566V possibly damaging Het
Sorbs3 A T 14: 70,184,099 N594K probably benign Het
Spata22 A T 11: 73,345,756 D296V probably damaging Het
Sphk2 G A 7: 45,713,634 A11V possibly damaging Het
Spp1 A T 5: 104,435,215 probably benign Het
Strn3 T A 12: 51,610,216 I760L possibly damaging Het
Syk A T 13: 52,641,986 Y539F probably benign Het
Thsd7b T A 1: 130,210,264 Y1560N probably benign Het
Tmod2 C A 9: 75,597,212 E42* probably null Het
Tom1l1 T C 11: 90,685,116 E30G probably damaging Het
Trav10 G A 14: 53,506,061 A40T probably benign Het
Trav14-2 G A 14: 53,640,780 probably benign Het
Tril T A 6: 53,818,464 E591V probably damaging Het
Trp53bp1 T A 2: 121,228,606 R179* probably null Het
Tspoap1 A T 11: 87,771,663 D562V possibly damaging Het
Usp44 A T 10: 93,846,906 H406L probably damaging Het
Vangl1 A G 3: 102,158,292 I509T probably benign Het
Vax2 T G 6: 83,711,397 L34W probably damaging Het
Vmn1r55 A T 7: 5,147,026 C133S probably damaging Het
Vmn2r8 T A 5: 108,801,700 D427V probably benign Het
Vwde A G 6: 13,205,852 I232T possibly damaging Het
Wnk1 C A 6: 119,963,470 A769S probably damaging Het
Xpo4 A C 14: 57,618,181 S264A probably benign Het
Zfp330 A T 8: 82,769,386 C75* probably null Het
Zfp526 T A 7: 25,225,639 L441Q probably benign Het
Zfp607b T G 7: 27,703,505 L462R probably damaging Het
Zfp719 T A 7: 43,590,793 F602I probably damaging Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20972141 missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20984299 splice site probably null
IGL01075:Ahi1 APN 10 20987025 missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20972060 missense probably damaging 0.99
IGL01128:Ahi1 APN 10 21074433 missense probably benign
IGL01527:Ahi1 APN 10 20960085 splice site probably benign
IGL01821:Ahi1 APN 10 21041243 critical splice donor site probably null
IGL02159:Ahi1 APN 10 21058177 missense probably benign 0.13
IGL02176:Ahi1 APN 10 20970916 missense probably benign 0.00
IGL02200:Ahi1 APN 10 20981314 splice site probably benign
IGL02232:Ahi1 APN 10 20981375 missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20970897 missense probably benign 0.00
IGL02323:Ahi1 APN 10 20972034 missense probably damaging 1.00
IGL02885:Ahi1 APN 10 21055113 missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20963799 missense probably damaging 1.00
IGL02971:Ahi1 APN 10 21000551 missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20970942 missense probably benign 0.00
IGL03192:Ahi1 APN 10 20965635 missense probably benign 0.00
IGL03377:Ahi1 APN 10 21018004 missense possibly damaging 0.51
arisen UTSW 10 21007768 missense possibly damaging 0.53
urspringt UTSW 10 20984393 missense probably damaging 1.00
P4717OSA:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20972075 missense probably damaging 1.00
R0559:Ahi1 UTSW 10 21000719 splice site probably benign
R0627:Ahi1 UTSW 10 20965522 missense probably benign 0.10
R0652:Ahi1 UTSW 10 20979461 missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20970843 splice site probably benign
R1209:Ahi1 UTSW 10 20963730 missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20972156 missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20959800 missense probably benign 0.00
R1634:Ahi1 UTSW 10 20965693 missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20963115 missense probably benign 0.18
R1818:Ahi1 UTSW 10 20988562 missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20959996 missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20970976 missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20970911 nonsense probably null
R2850:Ahi1 UTSW 10 21000593 missense probably benign 0.07
R2862:Ahi1 UTSW 10 20981408 missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20959947 missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20972078 missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20965545 missense probably benign 0.07
R4916:Ahi1 UTSW 10 20984404 missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20960076 missense probably benign 0.00
R5223:Ahi1 UTSW 10 20970919 missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20987022 missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20987005 missense probably damaging 1.00
R5665:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 21074427 missense probably benign
R5769:Ahi1 UTSW 10 20960082 critical splice donor site probably null
R5899:Ahi1 UTSW 10 21000566 missense probably benign 0.06
R5936:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20984393 missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20959926 missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 21058165 missense probably benign 0.26
R6135:Ahi1 UTSW 10 20969121 missense probably benign 0.01
R6240:Ahi1 UTSW 10 20977081 missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20969043 missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20979592 missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20977049 missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20960082 critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20963673 missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20965567 missense probably damaging 1.00
R6755:Ahi1 UTSW 10 21017913 missense probably damaging 0.98
R6927:Ahi1 UTSW 10 21055069 missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20963691 missense probably benign 0.02
R6967:Ahi1 UTSW 10 20988625 missense probably damaging 0.98
R7168:Ahi1 UTSW 10 21017932 missense probably benign 0.01
R7169:Ahi1 UTSW 10 21055019 missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20987077 missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20963750 missense probably benign 0.35
R7680:Ahi1 UTSW 10 21007768 missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20981431 critical splice donor site probably null
R7999:Ahi1 UTSW 10 20965681 missense probably benign 0.31
R8219:Ahi1 UTSW 10 21074436 missense probably benign 0.00
R8248:Ahi1 UTSW 10 20972092 missense probably benign 0.04
R8560:Ahi1 UTSW 10 20959915 missense probably benign 0.04
X0024:Ahi1 UTSW 10 21000592 missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 21041007 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCTGCTTTGGTTTCAGC -3'
(R):5'- CTGGCATACTAGTGCATCGC -3'

Sequencing Primer
(F):5'- GGTTTCAGCTGCTCTTCTGCAAG -3'
(R):5'- GCATACTAGTGCATCGCCTTTTCAG -3'
Posted On2015-11-11