Mutagenetix > Incidental Mutation

Incidental Mutation 'R4755:Ralgapa1'

357947

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

042033-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.812) question?

Stock #

R4755 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55712748 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 997 (S997P)

Ref Sequence

ENSEMBL: ENSMUSP00000151498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

probably damaging
Transcript: ENSMUST00000085385
AA Change: S997P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: S997P

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110687
AA Change: S997P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: S997P

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000219432
AA Change: S1044P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219529

Predicted Effect

probably damaging
Transcript: ENSMUST00000220367
AA Change: S997P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226244
AA Change: S1453P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.0787

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (112/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449A18Rik	T	A	3: 59,825,859		noncoding transcript	Het
Accs	T	C	2: 93,841,337	E236G	probably damaging	Het
Agrn	C	T	4: 156,173,522		probably benign	Het
Ahi1	A	G	10: 21,055,047	I929V	possibly damaging	Het
Akap5	C	A	12: 76,327,807	C4*	probably null	Het
Amotl2	A	T	9: 102,720,480	H146L	probably damaging	Het
Ank1	A	G	8: 23,104,974	N666S	probably damaging	Het
Atp10d	A	T	5: 72,246,166	T373S	probably benign	Het
Bpifb9b	T	A	2: 154,319,694	M582K	probably benign	Het
Brca2	T	A	5: 150,559,987		probably null	Het
C130079G13Rik	C	T	3: 59,936,314	A143V	probably benign	Het
C330021F23Rik	A	T	8: 3,583,922	S8C	probably damaging	Het
Ccdc149	A	G	5: 52,404,151	V229A	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdk5rap2	A	G	4: 70,238,425	S1617P	probably damaging	Het
Cenpk	A	T	13: 104,230,871	M37L	probably benign	Het
Cenpk	A	T	13: 104,249,512	H305L	probably benign	Het
Ces5a	C	A	8: 93,535,677	A11S	probably benign	Het
Cfap65	T	C	1: 74,928,361	E186G	probably damaging	Het
Cfh	T	A	1: 140,088,808	I593F	probably damaging	Het
Clstn2	C	T	9: 97,445,673	V961I	probably benign	Het
Cog5	T	A	12: 31,869,406		probably null	Het
Col4a4	T	C	1: 82,541,174	D100G	unknown	Het
Cyp3a41a	T	C	5: 145,715,506	D61G	probably damaging	Het
Dnah10	A	G	5: 124,747,745	N655S	probably benign	Het
Dnaic1	C	G	4: 41,610,269	T295R	probably damaging	Het
Dnajc6	C	T	4: 101,550,799	A44V	probably damaging	Het
Eif4enif1	A	T	11: 3,244,016	D960V	probably damaging	Het
Fam167b	C	T	4: 129,578,342	G12R	probably damaging	Het
Fam20b	A	T	1: 156,687,496	Y266*	probably null	Het
Fer1l6	T	A	15: 58,640,211	V1509D	probably benign	Het
Fhad1	A	T	4: 141,928,483	I105N	probably damaging	Het
Fmo2	T	C	1: 162,888,805	D71G	probably damaging	Het
Folr2	T	C	7: 101,843,799	T6A	possibly damaging	Het
Fry	A	C	5: 150,398,254	E1018A	probably damaging	Het
Gas2l2	A	G	11: 83,429,367	I21T	probably damaging	Het
Gfra1	T	C	19: 58,453,244	Y85C	probably damaging	Het
Gm9117	T	C	3: 93,938,786		probably null	Het
Gpld1	A	T	13: 24,979,688	Y43F	probably benign	Het
Gpld1	T	A	13: 24,979,692	Y44*	probably null	Het
Grid2	A	G	6: 63,908,988	T123A	probably benign	Het
Grina	T	C	15: 76,249,242	L305P	probably damaging	Het
Gucy1a1	G	A	3: 82,094,795	A659V	probably benign	Het
H2-T10	T	A	17: 36,118,945	K319*	probably null	Het
Hey2	A	T	10: 30,834,304	V151E	probably benign	Het
Ighv1-69	G	A	12: 115,623,558	T13I	probably benign	Het
Il1rap	C	A	16: 26,722,782	A591E	probably benign	Het
Ildr1	T	C	16: 36,722,021	L261P	probably benign	Het
Jak1	A	G	4: 101,174,157	Y463H	probably damaging	Het
Lrp1b	T	C	2: 41,269,273	I1666V	probably benign	Het
Lrp1b	T	A	2: 41,471,016	T592S	probably benign	Het
Lrrc36	A	G	8: 105,452,144	T445A	possibly damaging	Het
Ly9	G	A	1: 171,607,238	S29F	probably damaging	Het
Mapk7	A	C	11: 61,490,843	C32W	probably damaging	Het
March10	C	T	11: 105,364,476		probably benign	Het
Mier2	A	T	10: 79,549,197	M119K	probably damaging	Het
Mpv17	A	T	5: 31,145,982	C59*	probably null	Het
Mrpl27	G	A	11: 94,653,833		probably benign	Het
Myo18b	G	A	5: 112,874,474	Q351*	probably null	Het
Myo1a	A	G	10: 127,715,688	I704M	probably damaging	Het
Nadsyn1	A	G	7: 143,806,913	C373R	probably damaging	Het
Nckipsd	C	A	9: 108,814,739	A513E	probably benign	Het
Neb	T	C	2: 52,220,209	D209G	probably damaging	Het
Nkapl	T	A	13: 21,468,287	Q52L	unknown	Het
Nptx2	G	A	5: 144,546,440	S126N	probably benign	Het
Olfr13	G	A	6: 43,174,043	S19N	probably benign	Het
Olfr653	T	A	7: 104,580,061	Y138*	probably null	Het
Olfr829	A	T	9: 18,857,180	H185L	probably benign	Het
Olfr917	A	G	9: 38,665,832	V4A	probably benign	Het
Pclo	A	T	5: 14,714,348	R4278S	unknown	Het
Pcnx	T	G	12: 81,950,294	L988R	probably damaging	Het
Prl2c5	C	A	13: 13,189,385	N75K	probably benign	Het
Prpf19	T	G	19: 10,897,790		probably benign	Het
Rangap1	T	C	15: 81,712,917	T226A	probably benign	Het
Rimklb	G	A	6: 122,456,406	L262F	probably damaging	Het
Rnf169	A	G	7: 99,925,723	M555T	probably benign	Het
Rp1l1	A	T	14: 64,030,070	D1035V	probably benign	Het
Scd2	T	A	19: 44,301,352	L262Q	probably damaging	Het
Scgb2b12	T	A	7: 32,325,531	M84L	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sipa1l1	G	A	12: 82,372,386	V613I	possibly damaging	Het
Slc25a23	T	A	17: 57,052,794	D67V	possibly damaging	Het
Slc25a39	C	T	11: 102,406,666		probably benign	Het
Slc4a10	T	A	2: 62,296,988	F895Y	probably damaging	Het
Slc5a4a	A	C	10: 76,186,564	K578Q	probably benign	Het
Slc6a13	G	A	6: 121,325,049	G197S	probably damaging	Het
Smarca2	A	T	19: 26,654,483	E566V	possibly damaging	Het
Sorbs3	A	T	14: 70,184,099	N594K	probably benign	Het
Spata22	A	T	11: 73,345,756	D296V	probably damaging	Het
Sphk2	G	A	7: 45,713,634	A11V	possibly damaging	Het
Spp1	A	T	5: 104,435,215		probably benign	Het
Strn3	T	A	12: 51,610,216	I760L	possibly damaging	Het
Syk	A	T	13: 52,641,986	Y539F	probably benign	Het
Thsd7b	T	A	1: 130,210,264	Y1560N	probably benign	Het
Tmod2	C	A	9: 75,597,212	E42*	probably null	Het
Tom1l1	T	C	11: 90,685,116	E30G	probably damaging	Het
Trav10	G	A	14: 53,506,061	A40T	probably benign	Het
Trav14-2	G	A	14: 53,640,780		probably benign	Het
Tril	T	A	6: 53,818,464	E591V	probably damaging	Het
Trp53bp1	T	A	2: 121,228,606	R179*	probably null	Het
Tspoap1	A	T	11: 87,771,663	D562V	possibly damaging	Het
Usp44	A	T	10: 93,846,906	H406L	probably damaging	Het
Vangl1	A	G	3: 102,158,292	I509T	probably benign	Het
Vax2	T	G	6: 83,711,397	L34W	probably damaging	Het
Vmn1r55	A	T	7: 5,147,026	C133S	probably damaging	Het
Vmn2r8	T	A	5: 108,801,700	D427V	probably benign	Het
Vwde	A	G	6: 13,205,852	I232T	possibly damaging	Het
Wnk1	C	A	6: 119,963,470	A769S	probably damaging	Het
Xpo4	A	C	14: 57,618,181	S264A	probably benign	Het
Zfp330	A	T	8: 82,769,386	C75*	probably null	Het
Zfp526	T	A	7: 25,225,639	L441Q	probably benign	Het
Zfp607b	T	G	7: 27,703,505	L462R	probably damaging	Het
Zfp719	T	A	7: 43,590,793	F602I	probably damaging	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9011:Ralgapa1	UTSW	12	55605529	intron	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9446:Ralgapa1	UTSW	12	55708023	missense	probably damaging	0.97
R9684:Ralgapa1	UTSW	12	55612700	missense	possibly damaging	0.63
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCAGCGCTACATAGTGAG -3'
(R):5'- TCTGGACCTATGTTAGTCCAGTG -3'

Sequencing Primer
(F):5'- GCTACATAGTGAGCCCCTGAC -3'
(R):5'- GACCTATGTTAGTCCAGTGCTAGAC -3'

Posted On

2015-11-11