Incidental Mutation 'R4755:Syk'
ID 357956
Institutional Source Beutler Lab
Gene Symbol Syk
Ensembl Gene ENSMUSG00000021457
Gene Name spleen tyrosine kinase
Synonyms Sykb
MMRRC Submission 042033-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4755 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 52737209-52802828 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52796022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 539 (Y539F)
Ref Sequence ENSEMBL: ENSMUSP00000112914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055087] [ENSMUST00000118756] [ENSMUST00000120135]
AlphaFold P48025
Predicted Effect probably benign
Transcript: ENSMUST00000055087
AA Change: Y562F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457
AA Change: Y562F

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118756
AA Change: Y539F

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457
AA Change: Y539F

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120135
AA Change: Y562F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457
AA Change: Y562F

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Meta Mutation Damage Score 0.1907 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,733,280 (GRCm39) noncoding transcript Het
Aadacl2fm1 C T 3: 59,843,735 (GRCm39) A143V probably benign Het
Accs T C 2: 93,671,682 (GRCm39) E236G probably damaging Het
Agrn C T 4: 156,257,979 (GRCm39) probably benign Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Akap5 C A 12: 76,374,581 (GRCm39) C4* probably null Het
Amotl2 A T 9: 102,597,679 (GRCm39) H146L probably damaging Het
Ank1 A G 8: 23,594,990 (GRCm39) N666S probably damaging Het
Atp10d A T 5: 72,403,509 (GRCm39) T373S probably benign Het
Bpifb9b T A 2: 154,161,614 (GRCm39) M582K probably benign Het
Brca2 T A 5: 150,483,452 (GRCm39) probably null Het
Ccdc149 A G 5: 52,561,493 (GRCm39) V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdk5rap2 A G 4: 70,156,662 (GRCm39) S1617P probably damaging Het
Cenpk A T 13: 104,367,379 (GRCm39) M37L probably benign Het
Cenpk A T 13: 104,386,020 (GRCm39) H305L probably benign Het
Ces5a C A 8: 94,262,305 (GRCm39) A11S probably benign Het
Cfap65 T C 1: 74,967,520 (GRCm39) E186G probably damaging Het
Cfh T A 1: 140,016,546 (GRCm39) I593F probably damaging Het
Clstn2 C T 9: 97,327,726 (GRCm39) V961I probably benign Het
Cog5 T A 12: 31,919,405 (GRCm39) probably null Het
Col4a4 T C 1: 82,518,895 (GRCm39) D100G unknown Het
Cyp3a41a T C 5: 145,652,316 (GRCm39) D61G probably damaging Het
Dnah10 A G 5: 124,824,809 (GRCm39) N655S probably benign Het
Dnai1 C G 4: 41,610,269 (GRCm39) T295R probably damaging Het
Dnajc6 C T 4: 101,407,996 (GRCm39) A44V probably damaging Het
Eif4enif1 A T 11: 3,194,016 (GRCm39) D960V probably damaging Het
Fam167b C T 4: 129,472,135 (GRCm39) G12R probably damaging Het
Fam20b A T 1: 156,515,066 (GRCm39) Y266* probably null Het
Fer1l6 T A 15: 58,512,060 (GRCm39) V1509D probably benign Het
Fhad1 A T 4: 141,655,794 (GRCm39) I105N probably damaging Het
Fmo2 T C 1: 162,716,374 (GRCm39) D71G probably damaging Het
Folr2 T C 7: 101,493,006 (GRCm39) T6A possibly damaging Het
Fry A C 5: 150,321,719 (GRCm39) E1018A probably damaging Het
Gas2l2 A G 11: 83,320,193 (GRCm39) I21T probably damaging Het
Gfra1 T C 19: 58,441,676 (GRCm39) Y85C probably damaging Het
Gpld1 A T 13: 25,163,671 (GRCm39) Y43F probably benign Het
Gpld1 T A 13: 25,163,675 (GRCm39) Y44* probably null Het
Grid2 A G 6: 63,885,972 (GRCm39) T123A probably benign Het
Grina T C 15: 76,133,442 (GRCm39) L305P probably damaging Het
Gucy1a1 G A 3: 82,002,102 (GRCm39) A659V probably benign Het
H2-T10 T A 17: 36,429,837 (GRCm39) K319* probably null Het
Hey2 A T 10: 30,710,300 (GRCm39) V151E probably benign Het
Ighv1-69 G A 12: 115,587,178 (GRCm39) T13I probably benign Het
Il1rap C A 16: 26,541,532 (GRCm39) A591E probably benign Het
Ildr1 T C 16: 36,542,383 (GRCm39) L261P probably benign Het
Jak1 A G 4: 101,031,354 (GRCm39) Y463H probably damaging Het
Lrp1b T C 2: 41,159,285 (GRCm39) I1666V probably benign Het
Lrp1b T A 2: 41,361,028 (GRCm39) T592S probably benign Het
Lrrc36 A G 8: 106,178,776 (GRCm39) T445A possibly damaging Het
Ly9 G A 1: 171,434,806 (GRCm39) S29F probably damaging Het
Mapk7 A C 11: 61,381,669 (GRCm39) C32W probably damaging Het
Marchf10 C T 11: 105,255,302 (GRCm39) probably benign Het
Mier2 A T 10: 79,385,031 (GRCm39) M119K probably damaging Het
Mpv17 A T 5: 31,303,326 (GRCm39) C59* probably null Het
Mrpl27 G A 11: 94,544,659 (GRCm39) probably benign Het
Myo18b G A 5: 113,022,340 (GRCm39) Q351* probably null Het
Myo1a A G 10: 127,551,557 (GRCm39) I704M probably damaging Het
Nadsyn1 A G 7: 143,360,650 (GRCm39) C373R probably damaging Het
Nckipsd C A 9: 108,691,938 (GRCm39) A513E probably benign Het
Neb T C 2: 52,110,221 (GRCm39) D209G probably damaging Het
Nkapl T A 13: 21,652,457 (GRCm39) Q52L unknown Het
Nptx2 G A 5: 144,483,250 (GRCm39) S126N probably benign Het
Or2a7 G A 6: 43,150,977 (GRCm39) S19N probably benign Het
Or52d3 T A 7: 104,229,268 (GRCm39) Y138* probably null Het
Or7g17 A T 9: 18,768,476 (GRCm39) H185L probably benign Het
Or8b52 A G 9: 38,577,128 (GRCm39) V4A probably benign Het
Pclo A T 5: 14,764,362 (GRCm39) R4278S unknown Het
Pcnx1 T G 12: 81,997,068 (GRCm39) L988R probably damaging Het
Prl2c5 C A 13: 13,363,970 (GRCm39) N75K probably benign Het
Prpf19 T G 19: 10,875,154 (GRCm39) probably benign Het
Ralgapa1 A G 12: 55,759,533 (GRCm39) S997P probably damaging Het
Rangap1 T C 15: 81,597,118 (GRCm39) T226A probably benign Het
Rimklb G A 6: 122,433,365 (GRCm39) L262F probably damaging Het
Rnf169 A G 7: 99,574,930 (GRCm39) M555T probably benign Het
Rp1l1 A T 14: 64,267,519 (GRCm39) D1035V probably benign Het
Rps23rg1 A T 8: 3,633,922 (GRCm39) S8C probably damaging Het
Scd2 T A 19: 44,289,791 (GRCm39) L262Q probably damaging Het
Scgb2b12 T A 7: 32,024,956 (GRCm39) M84L probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 G A 12: 82,419,160 (GRCm39) V613I possibly damaging Het
Slc25a23 T A 17: 57,359,794 (GRCm39) D67V possibly damaging Het
Slc25a39 C T 11: 102,297,492 (GRCm39) probably benign Het
Slc4a10 T A 2: 62,127,332 (GRCm39) F895Y probably damaging Het
Slc5a4a A C 10: 76,022,398 (GRCm39) K578Q probably benign Het
Slc6a13 G A 6: 121,302,008 (GRCm39) G197S probably damaging Het
Smarca2 A T 19: 26,631,883 (GRCm39) E566V possibly damaging Het
Sorbs3 A T 14: 70,421,548 (GRCm39) N594K probably benign Het
Spata22 A T 11: 73,236,582 (GRCm39) D296V probably damaging Het
Sphk2 G A 7: 45,363,058 (GRCm39) A11V possibly damaging Het
Spp1 A T 5: 104,583,081 (GRCm39) probably benign Het
Strn3 T A 12: 51,656,999 (GRCm39) I760L possibly damaging Het
Tdpoz9-ps1 T C 3: 93,846,093 (GRCm39) probably null Het
Thsd7b T A 1: 130,138,001 (GRCm39) Y1560N probably benign Het
Tmod2 C A 9: 75,504,494 (GRCm39) E42* probably null Het
Tom1l1 T C 11: 90,575,942 (GRCm39) E30G probably damaging Het
Trav10 G A 14: 53,743,518 (GRCm39) A40T probably benign Het
Trav14-2 G A 14: 53,878,237 (GRCm39) probably benign Het
Tril T A 6: 53,795,449 (GRCm39) E591V probably damaging Het
Trp53bp1 T A 2: 121,059,087 (GRCm39) R179* probably null Het
Tspoap1 A T 11: 87,662,489 (GRCm39) D562V possibly damaging Het
Usp44 A T 10: 93,682,768 (GRCm39) H406L probably damaging Het
Vangl1 A G 3: 102,065,608 (GRCm39) I509T probably benign Het
Vax2 T G 6: 83,688,379 (GRCm39) L34W probably damaging Het
Vmn1r55 A T 7: 5,150,025 (GRCm39) C133S probably damaging Het
Vmn2r8 T A 5: 108,949,566 (GRCm39) D427V probably benign Het
Vwde A G 6: 13,205,851 (GRCm39) I232T possibly damaging Het
Wnk1 C A 6: 119,940,431 (GRCm39) A769S probably damaging Het
Xpo4 A C 14: 57,855,638 (GRCm39) S264A probably benign Het
Zfp330 A T 8: 83,496,015 (GRCm39) C75* probably null Het
Zfp526 T A 7: 24,925,064 (GRCm39) L441Q probably benign Het
Zfp607b T G 7: 27,402,930 (GRCm39) L462R probably damaging Het
Zfp719 T A 7: 43,240,217 (GRCm39) F602I probably damaging Het
Other mutations in Syk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52,778,784 (GRCm39) missense probably benign 0.00
IGL01522:Syk APN 13 52,797,097 (GRCm39) missense probably benign
IGL01957:Syk APN 13 52,785,776 (GRCm39) missense probably benign
IGL01962:Syk APN 13 52,764,993 (GRCm39) missense probably damaging 1.00
IGL02613:Syk APN 13 52,797,076 (GRCm39) missense probably damaging 0.97
IGL02824:Syk APN 13 52,777,319 (GRCm39) splice site probably benign
IGL03130:Syk APN 13 52,776,768 (GRCm39) missense probably benign 0.12
Apricot UTSW 13 52,794,769 (GRCm39) missense probably damaging 1.00
Poppy UTSW 13 52,794,769 (GRCm39) missense probably damaging 1.00
Sisyphus UTSW 13 52,794,826 (GRCm39) missense probably damaging 1.00
H8562:Syk UTSW 13 52,794,657 (GRCm39) missense probably damaging 1.00
R0091:Syk UTSW 13 52,794,769 (GRCm39) missense probably damaging 1.00
R0346:Syk UTSW 13 52,794,695 (GRCm39) missense probably damaging 1.00
R1888:Syk UTSW 13 52,794,826 (GRCm39) missense probably damaging 1.00
R1888:Syk UTSW 13 52,794,826 (GRCm39) missense probably damaging 1.00
R1917:Syk UTSW 13 52,776,744 (GRCm39) missense probably damaging 1.00
R2001:Syk UTSW 13 52,765,274 (GRCm39) missense probably benign 0.21
R2919:Syk UTSW 13 52,765,157 (GRCm39) missense probably benign
R3413:Syk UTSW 13 52,785,775 (GRCm39) missense probably benign
R3695:Syk UTSW 13 52,776,801 (GRCm39) splice site probably null
R4363:Syk UTSW 13 52,794,766 (GRCm39) missense probably damaging 1.00
R4754:Syk UTSW 13 52,766,295 (GRCm39) intron probably benign
R4806:Syk UTSW 13 52,786,963 (GRCm39) missense probably benign 0.14
R4817:Syk UTSW 13 52,765,242 (GRCm39) missense probably benign 0.03
R4903:Syk UTSW 13 52,765,117 (GRCm39) missense probably damaging 1.00
R4997:Syk UTSW 13 52,766,484 (GRCm39) nonsense probably null
R5066:Syk UTSW 13 52,796,018 (GRCm39) missense possibly damaging 0.49
R5114:Syk UTSW 13 52,765,071 (GRCm39) missense probably damaging 1.00
R5267:Syk UTSW 13 52,795,962 (GRCm39) missense probably benign 0.05
R5323:Syk UTSW 13 52,785,753 (GRCm39) missense probably benign 0.00
R5705:Syk UTSW 13 52,765,083 (GRCm39) missense probably benign 0.03
R6190:Syk UTSW 13 52,765,089 (GRCm39) missense probably damaging 0.97
R6892:Syk UTSW 13 52,786,934 (GRCm39) missense probably benign 0.00
R6932:Syk UTSW 13 52,766,495 (GRCm39) splice site probably null
R6977:Syk UTSW 13 52,787,094 (GRCm39) missense probably benign 0.00
R7496:Syk UTSW 13 52,766,452 (GRCm39) missense probably benign
R7650:Syk UTSW 13 52,765,131 (GRCm39) missense probably benign 0.24
R8081:Syk UTSW 13 52,792,195 (GRCm39) missense probably benign 0.00
R8199:Syk UTSW 13 52,778,768 (GRCm39) missense probably benign 0.00
R8350:Syk UTSW 13 52,774,935 (GRCm39) missense probably damaging 1.00
R8381:Syk UTSW 13 52,787,085 (GRCm39) missense probably benign 0.08
R8420:Syk UTSW 13 52,778,763 (GRCm39) missense probably benign 0.02
R8450:Syk UTSW 13 52,774,935 (GRCm39) missense probably damaging 1.00
R9177:Syk UTSW 13 52,766,480 (GRCm39) missense probably benign 0.37
R9689:Syk UTSW 13 52,778,808 (GRCm39) missense probably benign
Z1177:Syk UTSW 13 52,786,949 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGTGACTTTCAGCAGAGGC -3'
(R):5'- TAGCCGCCCACTGTTAGAAG -3'

Sequencing Primer
(F):5'- CAGCTCCTTTGTGCATCGGG -3'
(R):5'- CGCCCACTGTTAGAAGGTGATG -3'
Posted On 2015-11-11