Incidental Mutation 'R4755:Cenpk'
ID 357958
Institutional Source Beutler Lab
Gene Symbol Cenpk
Ensembl Gene ENSMUSG00000021714
Gene Name centromere protein K
Synonyms B130045K24Rik, Solt, C530004N04Rik
MMRRC Submission 042033-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.913) question?
Stock # R4755 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 104228611-104252392 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104249512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 305 (H305L)
Ref Sequence ENSEMBL: ENSMUSP00000022227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022227] [ENSMUST00000070761] [ENSMUST00000224500]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022227
AA Change: H305L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022227
Gene: ENSMUSG00000021714
AA Change: H305L

DomainStartEndE-ValueType
Pfam:CENP-K 47 306 1.5e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070761
SMART Domains Protein: ENSMUSP00000070910
Gene: ENSMUSG00000021714

DomainStartEndE-ValueType
Pfam:CENP-K 1 231 1.1e-99 PFAM
low complexity region 237 251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224098
Predicted Effect probably benign
Transcript: ENSMUST00000224500
Meta Mutation Damage Score 0.3563 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,859 (GRCm38) noncoding transcript Het
Aadacl2fm1 C T 3: 59,936,314 (GRCm38) A143V probably benign Het
Accs T C 2: 93,841,337 (GRCm38) E236G probably damaging Het
Agrn C T 4: 156,173,522 (GRCm38) probably benign Het
Ahi1 A G 10: 21,055,047 (GRCm38) I929V possibly damaging Het
Akap5 C A 12: 76,327,807 (GRCm38) C4* probably null Het
Amotl2 A T 9: 102,720,480 (GRCm38) H146L probably damaging Het
Ank1 A G 8: 23,104,974 (GRCm38) N666S probably damaging Het
Atp10d A T 5: 72,246,166 (GRCm38) T373S probably benign Het
Bpifb9b T A 2: 154,319,694 (GRCm38) M582K probably benign Het
Brca2 T A 5: 150,559,987 (GRCm38) probably null Het
Ccdc149 A G 5: 52,404,151 (GRCm38) V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 (GRCm38) probably benign Het
Cdk5rap2 A G 4: 70,238,425 (GRCm38) S1617P probably damaging Het
Ces5a C A 8: 93,535,677 (GRCm38) A11S probably benign Het
Cfap65 T C 1: 74,928,361 (GRCm38) E186G probably damaging Het
Cfh T A 1: 140,088,808 (GRCm38) I593F probably damaging Het
Clstn2 C T 9: 97,445,673 (GRCm38) V961I probably benign Het
Cog5 T A 12: 31,869,406 (GRCm38) probably null Het
Col4a4 T C 1: 82,541,174 (GRCm38) D100G unknown Het
Cyp3a41a T C 5: 145,715,506 (GRCm38) D61G probably damaging Het
Dnah10 A G 5: 124,747,745 (GRCm38) N655S probably benign Het
Dnai1 C G 4: 41,610,269 (GRCm38) T295R probably damaging Het
Dnajc6 C T 4: 101,550,799 (GRCm38) A44V probably damaging Het
Eif4enif1 A T 11: 3,244,016 (GRCm38) D960V probably damaging Het
Fam167b C T 4: 129,578,342 (GRCm38) G12R probably damaging Het
Fam20b A T 1: 156,687,496 (GRCm38) Y266* probably null Het
Fer1l6 T A 15: 58,640,211 (GRCm38) V1509D probably benign Het
Fhad1 A T 4: 141,928,483 (GRCm38) I105N probably damaging Het
Fmo2 T C 1: 162,888,805 (GRCm38) D71G probably damaging Het
Folr2 T C 7: 101,843,799 (GRCm38) T6A possibly damaging Het
Fry A C 5: 150,398,254 (GRCm38) E1018A probably damaging Het
Gas2l2 A G 11: 83,429,367 (GRCm38) I21T probably damaging Het
Gfra1 T C 19: 58,453,244 (GRCm38) Y85C probably damaging Het
Gpld1 A T 13: 24,979,688 (GRCm38) Y43F probably benign Het
Gpld1 T A 13: 24,979,692 (GRCm38) Y44* probably null Het
Grid2 A G 6: 63,908,988 (GRCm38) T123A probably benign Het
Grina T C 15: 76,249,242 (GRCm38) L305P probably damaging Het
Gucy1a1 G A 3: 82,094,795 (GRCm38) A659V probably benign Het
H2-T10 T A 17: 36,118,945 (GRCm38) K319* probably null Het
Hey2 A T 10: 30,834,304 (GRCm38) V151E probably benign Het
Ighv1-69 G A 12: 115,623,558 (GRCm38) T13I probably benign Het
Il1rap C A 16: 26,722,782 (GRCm38) A591E probably benign Het
Ildr1 T C 16: 36,722,021 (GRCm38) L261P probably benign Het
Jak1 A G 4: 101,174,157 (GRCm38) Y463H probably damaging Het
Lrp1b T C 2: 41,269,273 (GRCm38) I1666V probably benign Het
Lrp1b T A 2: 41,471,016 (GRCm38) T592S probably benign Het
Lrrc36 A G 8: 105,452,144 (GRCm38) T445A possibly damaging Het
Ly9 G A 1: 171,607,238 (GRCm38) S29F probably damaging Het
Mapk7 A C 11: 61,490,843 (GRCm38) C32W probably damaging Het
Marchf10 C T 11: 105,364,476 (GRCm38) probably benign Het
Mier2 A T 10: 79,549,197 (GRCm38) M119K probably damaging Het
Mpv17 A T 5: 31,145,982 (GRCm38) C59* probably null Het
Mrpl27 G A 11: 94,653,833 (GRCm38) probably benign Het
Myo18b G A 5: 112,874,474 (GRCm38) Q351* probably null Het
Myo1a A G 10: 127,715,688 (GRCm38) I704M probably damaging Het
Nadsyn1 A G 7: 143,806,913 (GRCm38) C373R probably damaging Het
Nckipsd C A 9: 108,814,739 (GRCm38) A513E probably benign Het
Neb T C 2: 52,220,209 (GRCm38) D209G probably damaging Het
Nkapl T A 13: 21,468,287 (GRCm38) Q52L unknown Het
Nptx2 G A 5: 144,546,440 (GRCm38) S126N probably benign Het
Or2a7 G A 6: 43,174,043 (GRCm38) S19N probably benign Het
Or52d3 T A 7: 104,580,061 (GRCm38) Y138* probably null Het
Or7g17 A T 9: 18,857,180 (GRCm38) H185L probably benign Het
Or8b52 A G 9: 38,665,832 (GRCm38) V4A probably benign Het
Pclo A T 5: 14,714,348 (GRCm38) R4278S unknown Het
Pcnx1 T G 12: 81,950,294 (GRCm38) L988R probably damaging Het
Prl2c5 C A 13: 13,189,385 (GRCm38) N75K probably benign Het
Prpf19 T G 19: 10,897,790 (GRCm38) probably benign Het
Ralgapa1 A G 12: 55,712,748 (GRCm38) S997P probably damaging Het
Rangap1 T C 15: 81,712,917 (GRCm38) T226A probably benign Het
Rimklb G A 6: 122,456,406 (GRCm38) L262F probably damaging Het
Rnf169 A G 7: 99,925,723 (GRCm38) M555T probably benign Het
Rp1l1 A T 14: 64,030,070 (GRCm38) D1035V probably benign Het
Rps23rg1 A T 8: 3,583,922 (GRCm38) S8C probably damaging Het
Scd2 T A 19: 44,301,352 (GRCm38) L262Q probably damaging Het
Scgb2b12 T A 7: 32,325,531 (GRCm38) M84L probably benign Het
Shroom3 G T 5: 92,943,086 (GRCm38) V1151F probably damaging Het
Sipa1l1 G A 12: 82,372,386 (GRCm38) V613I possibly damaging Het
Slc25a23 T A 17: 57,052,794 (GRCm38) D67V possibly damaging Het
Slc25a39 C T 11: 102,406,666 (GRCm38) probably benign Het
Slc4a10 T A 2: 62,296,988 (GRCm38) F895Y probably damaging Het
Slc5a4a A C 10: 76,186,564 (GRCm38) K578Q probably benign Het
Slc6a13 G A 6: 121,325,049 (GRCm38) G197S probably damaging Het
Smarca2 A T 19: 26,654,483 (GRCm38) E566V possibly damaging Het
Sorbs3 A T 14: 70,184,099 (GRCm38) N594K probably benign Het
Spata22 A T 11: 73,345,756 (GRCm38) D296V probably damaging Het
Sphk2 G A 7: 45,713,634 (GRCm38) A11V possibly damaging Het
Spp1 A T 5: 104,435,215 (GRCm38) probably benign Het
Strn3 T A 12: 51,610,216 (GRCm38) I760L possibly damaging Het
Syk A T 13: 52,641,986 (GRCm38) Y539F probably benign Het
Tdpoz9-ps1 T C 3: 93,938,786 (GRCm38) probably null Het
Thsd7b T A 1: 130,210,264 (GRCm38) Y1560N probably benign Het
Tmod2 C A 9: 75,597,212 (GRCm38) E42* probably null Het
Tom1l1 T C 11: 90,685,116 (GRCm38) E30G probably damaging Het
Trav10 G A 14: 53,506,061 (GRCm38) A40T probably benign Het
Trav14-2 G A 14: 53,640,780 (GRCm38) probably benign Het
Tril T A 6: 53,818,464 (GRCm38) E591V probably damaging Het
Trp53bp1 T A 2: 121,228,606 (GRCm38) R179* probably null Het
Tspoap1 A T 11: 87,771,663 (GRCm38) D562V possibly damaging Het
Usp44 A T 10: 93,846,906 (GRCm38) H406L probably damaging Het
Vangl1 A G 3: 102,158,292 (GRCm38) I509T probably benign Het
Vax2 T G 6: 83,711,397 (GRCm38) L34W probably damaging Het
Vmn1r55 A T 7: 5,147,026 (GRCm38) C133S probably damaging Het
Vmn2r8 T A 5: 108,801,700 (GRCm38) D427V probably benign Het
Vwde A G 6: 13,205,852 (GRCm38) I232T possibly damaging Het
Wnk1 C A 6: 119,963,470 (GRCm38) A769S probably damaging Het
Xpo4 A C 14: 57,618,181 (GRCm38) S264A probably benign Het
Zfp330 A T 8: 82,769,386 (GRCm38) C75* probably null Het
Zfp526 T A 7: 25,225,639 (GRCm38) L441Q probably benign Het
Zfp607b T G 7: 27,703,505 (GRCm38) L462R probably damaging Het
Zfp719 T A 7: 43,590,793 (GRCm38) F602I probably damaging Het
Other mutations in Cenpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cenpk APN 13 104,236,234 (GRCm38) unclassified probably benign
IGL02885:Cenpk APN 13 104,249,395 (GRCm38) missense probably damaging 0.97
IGL03107:Cenpk APN 13 104,242,772 (GRCm38) missense probably damaging 0.99
IGL03122:Cenpk APN 13 104,242,377 (GRCm38) missense probably damaging 1.00
R0421:Cenpk UTSW 13 104,242,403 (GRCm38) missense probably benign 0.36
R0423:Cenpk UTSW 13 104,234,225 (GRCm38) missense probably benign 0.00
R1261:Cenpk UTSW 13 104,230,785 (GRCm38) missense possibly damaging 0.90
R1262:Cenpk UTSW 13 104,230,785 (GRCm38) missense possibly damaging 0.90
R2069:Cenpk UTSW 13 104,236,176 (GRCm38) unclassified probably benign
R2105:Cenpk UTSW 13 104,229,597 (GRCm38) nonsense probably null
R2183:Cenpk UTSW 13 104,234,163 (GRCm38) missense probably damaging 0.99
R2509:Cenpk UTSW 13 104,234,167 (GRCm38) splice site probably null
R4625:Cenpk UTSW 13 104,249,393 (GRCm38) missense possibly damaging 0.86
R4755:Cenpk UTSW 13 104,230,871 (GRCm38) missense probably benign 0.02
R5217:Cenpk UTSW 13 104,249,409 (GRCm38) missense probably damaging 1.00
R5865:Cenpk UTSW 13 104,236,194 (GRCm38) makesense probably null
R6928:Cenpk UTSW 13 104,228,992 (GRCm38) start gained probably benign
R7109:Cenpk UTSW 13 104,230,748 (GRCm38) missense probably benign 0.44
R7444:Cenpk UTSW 13 104,249,517 (GRCm38) makesense probably null
R8870:Cenpk UTSW 13 104,230,857 (GRCm38) missense probably damaging 1.00
R9071:Cenpk UTSW 13 104,242,362 (GRCm38) nonsense probably null
R9514:Cenpk UTSW 13 104,234,174 (GRCm38) missense probably benign 0.12
R9769:Cenpk UTSW 13 104,245,302 (GRCm38) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTTCCCCACAAAAGGTATATTTC -3'
(R):5'- GTCGTGAAGGACTGTAAACCAAC -3'

Sequencing Primer
(F):5'- TTGGCCACCATATATTGAG -3'
(R):5'- TGAAGGACTGTAAACCAACTGAATAC -3'
Posted On 2015-11-11