Incidental Mutation 'R4755:Fer1l6'
ID 357964
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1 like family member 6
Synonyms EG631797
MMRRC Submission 042033-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R4755 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 58381897-58536936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58512060 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1509 (V1509D)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159705
Predicted Effect probably benign
Transcript: ENSMUST00000161028
AA Change: V1509D

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: V1509D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Meta Mutation Damage Score 0.2710 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,733,280 (GRCm39) noncoding transcript Het
Aadacl2fm1 C T 3: 59,843,735 (GRCm39) A143V probably benign Het
Accs T C 2: 93,671,682 (GRCm39) E236G probably damaging Het
Agrn C T 4: 156,257,979 (GRCm39) probably benign Het
Ahi1 A G 10: 20,930,946 (GRCm39) I929V possibly damaging Het
Akap5 C A 12: 76,374,581 (GRCm39) C4* probably null Het
Amotl2 A T 9: 102,597,679 (GRCm39) H146L probably damaging Het
Ank1 A G 8: 23,594,990 (GRCm39) N666S probably damaging Het
Atp10d A T 5: 72,403,509 (GRCm39) T373S probably benign Het
Bpifb9b T A 2: 154,161,614 (GRCm39) M582K probably benign Het
Brca2 T A 5: 150,483,452 (GRCm39) probably null Het
Ccdc149 A G 5: 52,561,493 (GRCm39) V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdk5rap2 A G 4: 70,156,662 (GRCm39) S1617P probably damaging Het
Cenpk A T 13: 104,367,379 (GRCm39) M37L probably benign Het
Cenpk A T 13: 104,386,020 (GRCm39) H305L probably benign Het
Ces5a C A 8: 94,262,305 (GRCm39) A11S probably benign Het
Cfap65 T C 1: 74,967,520 (GRCm39) E186G probably damaging Het
Cfh T A 1: 140,016,546 (GRCm39) I593F probably damaging Het
Clstn2 C T 9: 97,327,726 (GRCm39) V961I probably benign Het
Cog5 T A 12: 31,919,405 (GRCm39) probably null Het
Col4a4 T C 1: 82,518,895 (GRCm39) D100G unknown Het
Cyp3a41a T C 5: 145,652,316 (GRCm39) D61G probably damaging Het
Dnah10 A G 5: 124,824,809 (GRCm39) N655S probably benign Het
Dnai1 C G 4: 41,610,269 (GRCm39) T295R probably damaging Het
Dnajc6 C T 4: 101,407,996 (GRCm39) A44V probably damaging Het
Eif4enif1 A T 11: 3,194,016 (GRCm39) D960V probably damaging Het
Fam167b C T 4: 129,472,135 (GRCm39) G12R probably damaging Het
Fam20b A T 1: 156,515,066 (GRCm39) Y266* probably null Het
Fhad1 A T 4: 141,655,794 (GRCm39) I105N probably damaging Het
Fmo2 T C 1: 162,716,374 (GRCm39) D71G probably damaging Het
Folr2 T C 7: 101,493,006 (GRCm39) T6A possibly damaging Het
Fry A C 5: 150,321,719 (GRCm39) E1018A probably damaging Het
Gas2l2 A G 11: 83,320,193 (GRCm39) I21T probably damaging Het
Gfra1 T C 19: 58,441,676 (GRCm39) Y85C probably damaging Het
Gpld1 A T 13: 25,163,671 (GRCm39) Y43F probably benign Het
Gpld1 T A 13: 25,163,675 (GRCm39) Y44* probably null Het
Grid2 A G 6: 63,885,972 (GRCm39) T123A probably benign Het
Grina T C 15: 76,133,442 (GRCm39) L305P probably damaging Het
Gucy1a1 G A 3: 82,002,102 (GRCm39) A659V probably benign Het
H2-T10 T A 17: 36,429,837 (GRCm39) K319* probably null Het
Hey2 A T 10: 30,710,300 (GRCm39) V151E probably benign Het
Ighv1-69 G A 12: 115,587,178 (GRCm39) T13I probably benign Het
Il1rap C A 16: 26,541,532 (GRCm39) A591E probably benign Het
Ildr1 T C 16: 36,542,383 (GRCm39) L261P probably benign Het
Jak1 A G 4: 101,031,354 (GRCm39) Y463H probably damaging Het
Lrp1b T C 2: 41,159,285 (GRCm39) I1666V probably benign Het
Lrp1b T A 2: 41,361,028 (GRCm39) T592S probably benign Het
Lrrc36 A G 8: 106,178,776 (GRCm39) T445A possibly damaging Het
Ly9 G A 1: 171,434,806 (GRCm39) S29F probably damaging Het
Mapk7 A C 11: 61,381,669 (GRCm39) C32W probably damaging Het
Marchf10 C T 11: 105,255,302 (GRCm39) probably benign Het
Mier2 A T 10: 79,385,031 (GRCm39) M119K probably damaging Het
Mpv17 A T 5: 31,303,326 (GRCm39) C59* probably null Het
Mrpl27 G A 11: 94,544,659 (GRCm39) probably benign Het
Myo18b G A 5: 113,022,340 (GRCm39) Q351* probably null Het
Myo1a A G 10: 127,551,557 (GRCm39) I704M probably damaging Het
Nadsyn1 A G 7: 143,360,650 (GRCm39) C373R probably damaging Het
Nckipsd C A 9: 108,691,938 (GRCm39) A513E probably benign Het
Neb T C 2: 52,110,221 (GRCm39) D209G probably damaging Het
Nkapl T A 13: 21,652,457 (GRCm39) Q52L unknown Het
Nptx2 G A 5: 144,483,250 (GRCm39) S126N probably benign Het
Or2a7 G A 6: 43,150,977 (GRCm39) S19N probably benign Het
Or52d3 T A 7: 104,229,268 (GRCm39) Y138* probably null Het
Or7g17 A T 9: 18,768,476 (GRCm39) H185L probably benign Het
Or8b52 A G 9: 38,577,128 (GRCm39) V4A probably benign Het
Pclo A T 5: 14,764,362 (GRCm39) R4278S unknown Het
Pcnx1 T G 12: 81,997,068 (GRCm39) L988R probably damaging Het
Prl2c5 C A 13: 13,363,970 (GRCm39) N75K probably benign Het
Prpf19 T G 19: 10,875,154 (GRCm39) probably benign Het
Ralgapa1 A G 12: 55,759,533 (GRCm39) S997P probably damaging Het
Rangap1 T C 15: 81,597,118 (GRCm39) T226A probably benign Het
Rimklb G A 6: 122,433,365 (GRCm39) L262F probably damaging Het
Rnf169 A G 7: 99,574,930 (GRCm39) M555T probably benign Het
Rp1l1 A T 14: 64,267,519 (GRCm39) D1035V probably benign Het
Rps23rg1 A T 8: 3,633,922 (GRCm39) S8C probably damaging Het
Scd2 T A 19: 44,289,791 (GRCm39) L262Q probably damaging Het
Scgb2b12 T A 7: 32,024,956 (GRCm39) M84L probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 G A 12: 82,419,160 (GRCm39) V613I possibly damaging Het
Slc25a23 T A 17: 57,359,794 (GRCm39) D67V possibly damaging Het
Slc25a39 C T 11: 102,297,492 (GRCm39) probably benign Het
Slc4a10 T A 2: 62,127,332 (GRCm39) F895Y probably damaging Het
Slc5a4a A C 10: 76,022,398 (GRCm39) K578Q probably benign Het
Slc6a13 G A 6: 121,302,008 (GRCm39) G197S probably damaging Het
Smarca2 A T 19: 26,631,883 (GRCm39) E566V possibly damaging Het
Sorbs3 A T 14: 70,421,548 (GRCm39) N594K probably benign Het
Spata22 A T 11: 73,236,582 (GRCm39) D296V probably damaging Het
Sphk2 G A 7: 45,363,058 (GRCm39) A11V possibly damaging Het
Spp1 A T 5: 104,583,081 (GRCm39) probably benign Het
Strn3 T A 12: 51,656,999 (GRCm39) I760L possibly damaging Het
Syk A T 13: 52,796,022 (GRCm39) Y539F probably benign Het
Tdpoz9-ps1 T C 3: 93,846,093 (GRCm39) probably null Het
Thsd7b T A 1: 130,138,001 (GRCm39) Y1560N probably benign Het
Tmod2 C A 9: 75,504,494 (GRCm39) E42* probably null Het
Tom1l1 T C 11: 90,575,942 (GRCm39) E30G probably damaging Het
Trav10 G A 14: 53,743,518 (GRCm39) A40T probably benign Het
Trav14-2 G A 14: 53,878,237 (GRCm39) probably benign Het
Tril T A 6: 53,795,449 (GRCm39) E591V probably damaging Het
Trp53bp1 T A 2: 121,059,087 (GRCm39) R179* probably null Het
Tspoap1 A T 11: 87,662,489 (GRCm39) D562V possibly damaging Het
Usp44 A T 10: 93,682,768 (GRCm39) H406L probably damaging Het
Vangl1 A G 3: 102,065,608 (GRCm39) I509T probably benign Het
Vax2 T G 6: 83,688,379 (GRCm39) L34W probably damaging Het
Vmn1r55 A T 7: 5,150,025 (GRCm39) C133S probably damaging Het
Vmn2r8 T A 5: 108,949,566 (GRCm39) D427V probably benign Het
Vwde A G 6: 13,205,851 (GRCm39) I232T possibly damaging Het
Wnk1 C A 6: 119,940,431 (GRCm39) A769S probably damaging Het
Xpo4 A C 14: 57,855,638 (GRCm39) S264A probably benign Het
Zfp330 A T 8: 83,496,015 (GRCm39) C75* probably null Het
Zfp526 T A 7: 24,925,064 (GRCm39) L441Q probably benign Het
Zfp607b T G 7: 27,402,930 (GRCm39) L462R probably damaging Het
Zfp719 T A 7: 43,240,217 (GRCm39) F602I probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58,534,636 (GRCm39) missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58,430,251 (GRCm39) missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58,509,763 (GRCm39) splice site probably null
R0304:Fer1l6 UTSW 15 58,462,411 (GRCm39) missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58,420,187 (GRCm39) missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58,509,943 (GRCm39) critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58,430,257 (GRCm39) splice site probably null
R0602:Fer1l6 UTSW 15 58,449,794 (GRCm39) missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58,534,784 (GRCm39) splice site probably null
R0669:Fer1l6 UTSW 15 58,425,573 (GRCm39) splice site probably null
R0854:Fer1l6 UTSW 15 58,431,037 (GRCm39) missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58,435,924 (GRCm39) missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R1483:Fer1l6 UTSW 15 58,509,819 (GRCm39) missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58,513,728 (GRCm39) missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58,518,930 (GRCm39) missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58,429,718 (GRCm39) missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58,497,080 (GRCm39) missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R2041:Fer1l6 UTSW 15 58,430,155 (GRCm39) missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2145:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2981:Fer1l6 UTSW 15 58,435,926 (GRCm39) missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58,431,087 (GRCm39) missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58,518,998 (GRCm39) missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58,499,371 (GRCm39) missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58,498,129 (GRCm39) critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58,512,075 (GRCm39) missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58,425,554 (GRCm39) missense probably damaging 1.00
R4774:Fer1l6 UTSW 15 58,449,798 (GRCm39) missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58,490,751 (GRCm39) missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58,509,869 (GRCm39) missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58,472,160 (GRCm39) critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58,443,250 (GRCm39) missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58,515,769 (GRCm39) missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58,512,003 (GRCm39) missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58,422,126 (GRCm39) missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58,453,752 (GRCm39) nonsense probably null
R5561:Fer1l6 UTSW 15 58,532,674 (GRCm39) missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58,430,175 (GRCm39) missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58,494,331 (GRCm39) missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58,443,238 (GRCm39) missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58,462,399 (GRCm39) nonsense probably null
R5823:Fer1l6 UTSW 15 58,462,352 (GRCm39) nonsense probably null
R5892:Fer1l6 UTSW 15 58,435,917 (GRCm39) missense probably benign
R6006:Fer1l6 UTSW 15 58,518,893 (GRCm39) missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58,431,055 (GRCm39) missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58,509,806 (GRCm39) missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58,432,488 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,509,855 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,497,026 (GRCm39) nonsense probably null
R6271:Fer1l6 UTSW 15 58,513,767 (GRCm39) missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58,431,081 (GRCm39) nonsense probably null
R6784:Fer1l6 UTSW 15 58,443,275 (GRCm39) missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58,466,727 (GRCm39) missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58,501,227 (GRCm39) missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58,435,899 (GRCm39) missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58,447,146 (GRCm39) missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58,462,384 (GRCm39) missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58,499,446 (GRCm39) missense probably benign
R7463:Fer1l6 UTSW 15 58,445,450 (GRCm39) nonsense probably null
R7464:Fer1l6 UTSW 15 58,445,096 (GRCm39) splice site probably null
R7469:Fer1l6 UTSW 15 58,462,419 (GRCm39) splice site probably null
R7483:Fer1l6 UTSW 15 58,513,794 (GRCm39) missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58,472,281 (GRCm39) missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58,509,875 (GRCm39) missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58,432,331 (GRCm39) missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58,430,245 (GRCm39) missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58,499,438 (GRCm39) missense probably benign
R7607:Fer1l6 UTSW 15 58,534,581 (GRCm39) nonsense probably null
R7677:Fer1l6 UTSW 15 58,474,139 (GRCm39) missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58,502,486 (GRCm39) missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58,432,345 (GRCm39) missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58,414,012 (GRCm39) missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58,455,329 (GRCm39) missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58,502,594 (GRCm39) missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58,515,715 (GRCm39) missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58,494,230 (GRCm39) missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58,490,766 (GRCm39) missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58,429,759 (GRCm39) missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58,490,370 (GRCm39) missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58,422,113 (GRCm39) missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58,497,098 (GRCm39) missense probably benign
X0021:Fer1l6 UTSW 15 58,441,051 (GRCm39) nonsense probably null
X0027:Fer1l6 UTSW 15 58,501,189 (GRCm39) missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58,490,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTGCTCCCCTAGAGTG -3'
(R):5'- ACCAGGATGCAGTGTCGTTC -3'

Sequencing Primer
(F):5'- CTAGAGTGCAACCAGGCTC -3'
(R):5'- ATGCAGTGTCGTTCCCTGAGC -3'
Posted On 2015-11-11