Incidental Mutation 'R4756:Mob4'
ID357976
Institutional Source Beutler Lab
Gene Symbol Mob4
Ensembl Gene ENSMUSG00000025979
Gene NameMOB family member 4, phocein
SynonymsMobkl3, Prei3
MMRRC Submission 041972-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location55131231-55154899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55152696 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 190 (R190W)
Ref Sequence ENSEMBL: ENSMUSP00000125415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027122] [ENSMUST00000159311] [ENSMUST00000161122] [ENSMUST00000162364] [ENSMUST00000162553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027122
AA Change: R148W

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027122
Gene: ENSMUSG00000025979
AA Change: R148W

DomainStartEndE-ValueType
Pfam:Mob1_phocein 28 168 1.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159311
AA Change: R169W

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124790
Gene: ENSMUSG00000025979
AA Change: R169W

DomainStartEndE-ValueType
Pfam:Mob1_phocein 19 189 9.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161122
Predicted Effect probably damaging
Transcript: ENSMUST00000162364
AA Change: R190W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125415
Gene: ENSMUSG00000025979
AA Change: R190W

DomainStartEndE-ValueType
Mob1_phocein 42 209 1.89e-58 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162553
AA Change: R158W

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124151
Gene: ENSMUSG00000025979
AA Change: R158W

DomainStartEndE-ValueType
Pfam:Mob1_phocein 8 178 3.9e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187422
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Mob4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03340:Mob4 APN 1 55136708 missense possibly damaging 0.50
R4831:Mob4 UTSW 1 55152740 missense probably benign 0.01
R4832:Mob4 UTSW 1 55145252 intron probably benign
R4876:Mob4 UTSW 1 55152836 unclassified probably benign
R4972:Mob4 UTSW 1 55151002 missense possibly damaging 0.96
R5747:Mob4 UTSW 1 55148578 missense probably damaging 1.00
R6717:Mob4 UTSW 1 55136713 missense possibly damaging 0.91
R6774:Mob4 UTSW 1 55148429 splice site probably null
R6925:Mob4 UTSW 1 55152722 nonsense probably null
R7447:Mob4 UTSW 1 55131466 start gained probably benign
R7721:Mob4 UTSW 1 55148320 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTAGCTTGTGTCAAGTCAACAG -3'
(R):5'- ACACCAGTGAATATACAGCTCATG -3'

Sequencing Primer
(F):5'- GCTTGTGTCAAGTCAACAGAAAAC -3'
(R):5'- TTCCCATTTAAAAAGGCAACACATAG -3'
Posted On2015-11-11