Incidental Mutation 'R4756:Camk1g'
ID357981
Institutional Source Beutler Lab
Gene Symbol Camk1g
Ensembl Gene ENSMUSG00000016179
Gene Namecalcium/calmodulin-dependent protein kinase I gamma
SynonymsCLICK-III, CaMKIgamma
MMRRC Submission 041972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location193346346-193370298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 193362085 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 7 (E7V)
Ref Sequence ENSEMBL: ENSMUSP00000128143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016323] [ENSMUST00000169907]
Predicted Effect probably benign
Transcript: ENSMUST00000016323
AA Change: E7V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016323
Gene: ENSMUSG00000016179
AA Change: E7V

DomainStartEndE-ValueType
S_TKc 23 277 9.53e-112 SMART
low complexity region 376 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163202
SMART Domains Protein: ENSMUSP00000131451
Gene: ENSMUSG00000016179

DomainStartEndE-ValueType
S_TKc 2 238 5.19e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165718
Predicted Effect probably benign
Transcript: ENSMUST00000169907
AA Change: E7V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128143
Gene: ENSMUSG00000016179
AA Change: E7V

DomainStartEndE-ValueType
S_TKc 23 277 9.53e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191875
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to calcium/calmodulin dependent protein kinase, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Camk1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Camk1g APN 1 193347349 unclassified probably benign
IGL02637:Camk1g APN 1 193348388 missense probably benign 0.38
G1patch:Camk1g UTSW 1 193350320 missense possibly damaging 0.80
I2288:Camk1g UTSW 1 193351106 splice site probably benign
R0375:Camk1g UTSW 1 193356401 splice site probably benign
R0433:Camk1g UTSW 1 193354058 missense probably damaging 0.99
R0967:Camk1g UTSW 1 193350296 missense probably damaging 1.00
R1161:Camk1g UTSW 1 193348354 missense probably benign
R1227:Camk1g UTSW 1 193347433 missense possibly damaging 0.73
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1641:Camk1g UTSW 1 193356357 missense probably benign 0.25
R3109:Camk1g UTSW 1 193354993 missense probably damaging 1.00
R3160:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3161:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R4638:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4642:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4644:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4781:Camk1g UTSW 1 193356344 missense probably benign 0.00
R4987:Camk1g UTSW 1 193348475 missense probably damaging 0.99
R5224:Camk1g UTSW 1 193355034 missense probably damaging 1.00
R5407:Camk1g UTSW 1 193347372 splice site probably null
R5932:Camk1g UTSW 1 193354039 missense probably benign 0.25
R6725:Camk1g UTSW 1 193350320 missense possibly damaging 0.80
R7071:Camk1g UTSW 1 193359809 missense probably benign 0.10
R7808:Camk1g UTSW 1 193350285 missense possibly damaging 0.51
R7908:Camk1g UTSW 1 193359774 missense probably damaging 1.00
R8135:Camk1g UTSW 1 193354027 missense possibly damaging 0.79
R8355:Camk1g UTSW 1 193351047 missense probably damaging 1.00
R8737:Camk1g UTSW 1 193348486 critical splice acceptor site probably null
R8811:Camk1g UTSW 1 193362100 missense probably damaging 1.00
Z1176:Camk1g UTSW 1 193362100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACCTTTTATGCCCCTGG -3'
(R):5'- TCTCAGGTTCTACTCCCAGG -3'

Sequencing Primer
(F):5'- TTATGCCCCTGGAATCACAG -3'
(R):5'- AGGTTCTACTCCCAGGCTTTC -3'
Posted On2015-11-11