Incidental Mutation 'R4756:Spag17'
ID357991
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission 041972-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100103385 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 2065 (K2065R)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145279
Predicted Effect possibly damaging
Transcript: ENSMUST00000164539
AA Change: K2065R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: K2065R

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7126:Spag17 UTSW 3 100101435 missense probably benign 0.00
R7144:Spag17 UTSW 3 100027401 splice site probably null
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100095595 nonsense probably null
R7772:Spag17 UTSW 3 100080118 missense probably damaging 0.98
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTGAGAATATCCAAGAGTCTCCTAG -3'
(R):5'- AGTGCCATGCCCGAGTAAC -3'

Sequencing Primer
(F):5'- TATCCAAGAGTCTCCTAGGGAAAAAG -3'
(R):5'- AAGTGCCTGAACTCTCAGTG -3'
Posted On2015-11-11