Incidental Mutation 'R4756:Clcc1'
ID357993
Institutional Source Beutler Lab
Gene Symbol Clcc1
Ensembl Gene ENSMUSG00000027884
Gene Namechloride channel CLIC-like 1
SynonymsMclc
MMRRC Submission 041972-MU
Accession Numbers

Ncbi RefSeq: NM_001177770.1, NM_145543.2, NM_001177771.1; MGI:2385186

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108653913-108678840 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 108672920 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029483] [ENSMUST00000106609] [ENSMUST00000106613]
Predicted Effect probably null
Transcript: ENSMUST00000029483
SMART Domains Protein: ENSMUSP00000029483
Gene: ENSMUSG00000027884

DomainStartEndE-ValueType
Pfam:MCLC 3 539 2e-266 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106609
SMART Domains Protein: ENSMUSP00000102220
Gene: ENSMUSG00000027884

DomainStartEndE-ValueType
Pfam:MCLC 3 539 2e-266 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106613
SMART Domains Protein: ENSMUSP00000102224
Gene: ENSMUSG00000027884

DomainStartEndE-ValueType
Pfam:MCLC 8 544 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156811
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show strain-dependent cerebellar granule cell death and peripheral motor axon degeneration. The peripheral neuropathy, neurogenic muscular atrophy and mild truncal ataxia observed on the C57BL/6J background is not found on the C3H/HeSnJ background. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted(1) Gene trapped(11)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Clcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Clcc1 APN 3 108670903 missense probably benign 0.04
IGL01683:Clcc1 APN 3 108676796 missense probably benign 0.00
IGL02067:Clcc1 APN 3 108668721 missense probably damaging 0.99
IGL02341:Clcc1 APN 3 108673383 missense possibly damaging 0.60
B6584:Clcc1 UTSW 3 108672913 missense probably damaging 1.00
R0014:Clcc1 UTSW 3 108661396 nonsense probably null
R0733:Clcc1 UTSW 3 108674740 missense probably benign 0.00
R1151:Clcc1 UTSW 3 108668043 missense probably damaging 1.00
R1432:Clcc1 UTSW 3 108668102 missense probably benign 0.11
R3546:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3547:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3548:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3932:Clcc1 UTSW 3 108673366 missense probably damaging 1.00
R4210:Clcc1 UTSW 3 108663591 missense possibly damaging 0.90
R4211:Clcc1 UTSW 3 108663591 missense possibly damaging 0.90
R4856:Clcc1 UTSW 3 108676838 missense probably benign 0.02
R4886:Clcc1 UTSW 3 108676838 missense probably benign 0.02
R5858:Clcc1 UTSW 3 108661428 missense probably damaging 1.00
R6258:Clcc1 UTSW 3 108673308 missense possibly damaging 0.73
R6301:Clcc1 UTSW 3 108673366 missense probably damaging 1.00
R6414:Clcc1 UTSW 3 108676851 missense possibly damaging 0.90
R6944:Clcc1 UTSW 3 108670968 missense probably damaging 1.00
R6965:Clcc1 UTSW 3 108673309 missense probably damaging 0.99
R7331:Clcc1 UTSW 3 108668078 missense probably damaging 1.00
R7961:Clcc1 UTSW 3 108661458 missense probably damaging 1.00
R8009:Clcc1 UTSW 3 108661458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTACTAGTGGGTGGGCACAG -3'
(R):5'- TGAATCTCTCATAGAGCTCAAGC -3'

Sequencing Primer
(F):5'- CAGTCAAAACCAAACTGATCTTGTG -3'
(R):5'- AGGCCTTGAACGATGTCCTC -3'
Posted On2015-11-11