Incidental Mutation 'R4756:Nbn'
ID357996
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Namenibrin
SynonymsNbs1
MMRRC Submission 041972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location15957925-15992589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15981470 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 521 (S521T)
Ref Sequence ENSEMBL: ENSMUSP00000120829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
Predicted Effect probably benign
Transcript: ENSMUST00000029879
AA Change: S521T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: S521T

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149069
AA Change: S521T

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: S521T

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7159:Nbn UTSW 4 15983677 intron probably null
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
R7597:Nbn UTSW 4 15963911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGTTTCCTGGCCTGAGTAG -3'
(R):5'- ACTTGAACTGCCAACTCTGG -3'

Sequencing Primer
(F):5'- TTCCTTTTCAAACCTAAGGGAAAGGG -3'
(R):5'- TGGCTTTGTACTCCTCAGTAAC -3'
Posted On2015-11-11