Incidental Mutation 'R4756:Hnrnpdl'
ID358006
Institutional Source Beutler Lab
Gene Symbol Hnrnpdl
Ensembl Gene ENSMUSG00000029328
Gene Nameheterogeneous nuclear ribonucleoprotein D-like
SynonymsJKTBP, D5Wsu145e, hnRNP-DL, D5Ertd650e, Hnrpdl
MMRRC Submission 041972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100033577-100039664 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 100037924 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 69 (Y69*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031268] [ENSMUST00000086900] [ENSMUST00000128187] [ENSMUST00000149384] [ENSMUST00000169390]
Predicted Effect probably benign
Transcript: ENSMUST00000031268
SMART Domains Protein: ENSMUSP00000031268
Gene: ENSMUSG00000029326

DomainStartEndE-ValueType
Pfam:HAD_2 13 227 2.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086900
AA Change: Y167*
SMART Domains Protein: ENSMUSP00000084114
Gene: ENSMUSG00000029328
AA Change: Y167*

DomainStartEndE-ValueType
low complexity region 31 57 N/A INTRINSIC
low complexity region 70 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
RRM 149 221 1.74e-23 SMART
RRM 234 306 3.56e-20 SMART
low complexity region 315 344 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 370 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128187
AA Change: Y167*
SMART Domains Protein: ENSMUSP00000121005
Gene: ENSMUSG00000029328
AA Change: Y167*

DomainStartEndE-ValueType
low complexity region 31 57 N/A INTRINSIC
low complexity region 70 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
RRM 149 221 1.74e-23 SMART
RRM 234 306 3.56e-20 SMART
low complexity region 315 344 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 370 393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141337
Predicted Effect probably benign
Transcript: ENSMUST00000149384
SMART Domains Protein: ENSMUSP00000117589
Gene: ENSMUSG00000029328

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
Blast:RRM 28 59 1e-13 BLAST
low complexity region 63 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151323
Predicted Effect probably null
Transcript: ENSMUST00000153442
AA Change: Y69*
SMART Domains Protein: ENSMUSP00000118555
Gene: ENSMUSG00000029328
AA Change: Y69*

DomainStartEndE-ValueType
RRM 52 124 1.74e-23 SMART
RRM 137 209 3.56e-20 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
low complexity region 273 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169390
SMART Domains Protein: ENSMUSP00000129704
Gene: ENSMUSG00000029326

DomainStartEndE-ValueType
Pfam:HAD_2 13 227 2.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199518
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two RRM domains that bind to RNAs. Three alternatively spliced transcript variants have been described for this gene. One of the variants is probably not translated because the transcript is a candidate for nonsense-mediated mRNA decay. The protein isoforms encoded by this gene are similar to its family member HNRPD. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Hnrnpdl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02751:Hnrnpdl APN 5 100037974 missense probably damaging 1.00
IGL02981:Hnrnpdl APN 5 100037099 missense possibly damaging 0.75
IGL03087:Hnrnpdl APN 5 100037601 missense probably damaging 1.00
R4812:Hnrnpdl UTSW 5 100036472 unclassified probably benign
R5154:Hnrnpdl UTSW 5 100036512 nonsense probably null
R6082:Hnrnpdl UTSW 5 100036481 missense probably null 1.00
R6086:Hnrnpdl UTSW 5 100036481 missense probably null 1.00
R6143:Hnrnpdl UTSW 5 100036551 nonsense probably null
R6305:Hnrnpdl UTSW 5 100038658 unclassified probably benign
R6807:Hnrnpdl UTSW 5 100039136 missense probably null
R7309:Hnrnpdl UTSW 5 100037623 nonsense probably null
R7449:Hnrnpdl UTSW 5 100037155 missense probably damaging 0.99
R8098:Hnrnpdl UTSW 5 100037920 missense probably benign 0.05
R8922:Hnrnpdl UTSW 5 100036560 nonsense probably null
X0020:Hnrnpdl UTSW 5 100036569 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTGGAAGACAAGGCAGTTTG -3'
(R):5'- CAGCTGGCTTGAACAAGTG -3'

Sequencing Primer
(F):5'- CAGTTTGGACTTAAAAGCCTAGAGC -3'
(R):5'- CTGGCTTGAACAAGTGGTTAAG -3'
Posted On2015-11-11