Incidental Mutation 'R4756:Nod2'
ID358019
Institutional Source Beutler Lab
Gene Symbol Nod2
Ensembl Gene ENSMUSG00000055994
Gene Namenucleotide-binding oligomerization domain containing 2
SynonymsNlrc2, Card15, F830032C23Rik
MMRRC Submission 041972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location88647315-88688474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88664274 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 388 (F388C)
Ref Sequence ENSEMBL: ENSMUSP00000105262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054324] [ENSMUST00000109634] [ENSMUST00000118370]
Predicted Effect probably benign
Transcript: ENSMUST00000054324
AA Change: F403C

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000050538
Gene: ENSMUSG00000055994
AA Change: F403C

DomainStartEndE-ValueType
Pfam:CARD 4 92 5.3e-20 PFAM
Blast:CARD 100 177 8e-11 BLAST
Pfam:NACHT 288 458 1.8e-46 PFAM
low complexity region 521 554 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
LRR 781 811 3.15e1 SMART
LRR 813 836 1.12e2 SMART
LRR 837 864 8.53e0 SMART
LRR 865 892 1.58e-3 SMART
LRR 893 920 4.83e-1 SMART
LRR 921 948 1.13e0 SMART
LRR 949 976 4.68e-6 SMART
LRR 977 1004 7.78e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109634
AA Change: F388C

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105262
Gene: ENSMUSG00000055994
AA Change: F388C

DomainStartEndE-ValueType
Pfam:CARD 11 99 2.5e-22 PFAM
Pfam:CARD 111 195 2.1e-14 PFAM
Pfam:NACHT 273 443 1.2e-45 PFAM
low complexity region 506 539 N/A INTRINSIC
low complexity region 613 624 N/A INTRINSIC
LRR 766 796 3.15e1 SMART
LRR 798 821 1.12e2 SMART
LRR 822 849 8.53e0 SMART
LRR 850 877 1.58e-3 SMART
LRR 878 905 4.83e-1 SMART
LRR 906 933 1.13e0 SMART
LRR 934 961 4.68e-6 SMART
LRR 962 989 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118370
AA Change: F381C

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113773
Gene: ENSMUSG00000055994
AA Change: F381C

DomainStartEndE-ValueType
Pfam:CARD 4 92 1e-21 PFAM
Pfam:CARD 104 188 8.4e-14 PFAM
Pfam:NACHT 266 436 2.5e-45 PFAM
low complexity region 499 532 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
LRR 759 789 3.15e1 SMART
LRR 791 814 1.12e2 SMART
LRR 815 842 8.53e0 SMART
LRR 843 870 1.58e-3 SMART
LRR 871 898 4.83e-1 SMART
LRR 899 926 1.13e0 SMART
LRR 927 954 4.68e-6 SMART
LRR 955 982 7.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124091
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Nod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Nod2 APN 8 88663736 missense probably benign 0.02
IGL02299:Nod2 APN 8 88663742 missense possibly damaging 0.81
PIT4687001:Nod2 UTSW 8 88681646 missense probably damaging 1.00
R0305:Nod2 UTSW 8 88665323 missense probably damaging 1.00
R0391:Nod2 UTSW 8 88663778 missense probably benign 0.00
R0580:Nod2 UTSW 8 88664406 missense probably damaging 1.00
R0617:Nod2 UTSW 8 88653231 missense probably benign 0.00
R0815:Nod2 UTSW 8 88672662 splice site probably benign
R1460:Nod2 UTSW 8 88663812 missense probably damaging 1.00
R1528:Nod2 UTSW 8 88664589 missense possibly damaging 0.92
R1707:Nod2 UTSW 8 88670476 missense possibly damaging 0.59
R1934:Nod2 UTSW 8 88663719 missense probably benign
R1956:Nod2 UTSW 8 88664208 missense probably damaging 1.00
R1972:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R1973:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R2902:Nod2 UTSW 8 88675463 missense probably damaging 1.00
R2918:Nod2 UTSW 8 88652891 missense probably benign 0.02
R3435:Nod2 UTSW 8 88664009 missense possibly damaging 0.64
R3705:Nod2 UTSW 8 88653320 missense probably benign 0.02
R4395:Nod2 UTSW 8 88664391 missense probably damaging 1.00
R4612:Nod2 UTSW 8 88665036 missense possibly damaging 0.65
R5122:Nod2 UTSW 8 88664120 missense probably damaging 1.00
R5144:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R5166:Nod2 UTSW 8 88664247 missense possibly damaging 0.58
R5203:Nod2 UTSW 8 88664451 missense probably damaging 1.00
R5338:Nod2 UTSW 8 88672785 splice site probably null
R5614:Nod2 UTSW 8 88664196 missense probably damaging 1.00
R5746:Nod2 UTSW 8 88664342 missense probably damaging 0.98
R5834:Nod2 UTSW 8 88664639 missense possibly damaging 0.91
R6059:Nod2 UTSW 8 88664414 missense probably damaging 1.00
R6282:Nod2 UTSW 8 88670460 missense probably benign 0.02
R6707:Nod2 UTSW 8 88665189 missense probably benign
R6741:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R6838:Nod2 UTSW 8 88670458 missense possibly damaging 0.63
R7008:Nod2 UTSW 8 88663657 nonsense probably null
R7182:Nod2 UTSW 8 88663832 missense probably benign 0.01
R7324:Nod2 UTSW 8 88653066 missense probably damaging 1.00
R7344:Nod2 UTSW 8 88660582 missense probably damaging 1.00
R7588:Nod2 UTSW 8 88674908 missense possibly damaging 0.80
R7625:Nod2 UTSW 8 88665278 missense probably damaging 0.98
R7832:Nod2 UTSW 8 88660797 splice site probably null
R8104:Nod2 UTSW 8 88665057 missense possibly damaging 0.89
R8217:Nod2 UTSW 8 88664157 missense probably benign 0.06
R8840:Nod2 UTSW 8 88672751 missense probably benign 0.13
Z1088:Nod2 UTSW 8 88664146 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGGACGCTGCTCTTTGAG -3'
(R):5'- AGGTGGCACAAACCATGCAG -3'

Sequencing Primer
(F):5'- GCACTGCTGCTGGCCTG -3'
(R):5'- GCACAAACCATGCAGGGCTG -3'
Posted On2015-11-11