Incidental Mutation 'R4756:Xrn1'
ID358025
Institutional Source Beutler Lab
Gene Symbol Xrn1
Ensembl Gene ENSMUSG00000032410
Gene Name5'-3' exoribonuclease 1
SynonymsDhm2, mXrn1
MMRRC Submission 041972-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95954760-96057803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96039809 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 1425 (R1425K)
Ref Sequence ENSEMBL: ENSMUSP00000034981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034981] [ENSMUST00000185633]
Predicted Effect probably benign
Transcript: ENSMUST00000034981
AA Change: R1425K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034981
Gene: ENSMUSG00000032410
AA Change: R1425K

DomainStartEndE-ValueType
Pfam:XRN_N 1 227 8.4e-99 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1665 1684 N/A INTRINSIC
low complexity region 1696 1711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185633
AA Change: R1425K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140278
Gene: ENSMUSG00000032410
AA Change: R1425K

DomainStartEndE-ValueType
Pfam:XRN_N 1 228 1.2e-103 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1661 1680 N/A INTRINSIC
low complexity region 1692 1707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189281
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 5'-3' exonuclease family. The encoded protein may be involved in replication-dependent histone mRNA degradation, and interacts directly with the enhancer of mRNA-decapping protein 4. In addition to mRNA metabolism, a similar protein in yeast has been implicated in a variety of nuclear and cytoplasmic functions, including homologous recombination, meiosis, telomere maintenance, and microtubule assembly. Mutations in this gene are associated with osteosarcoma, suggesting that the encoded protein may also play a role in bone formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Xrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Xrn1 APN 9 96038949 missense probably benign 0.05
IGL00778:Xrn1 APN 9 95973447 splice site probably benign
IGL01936:Xrn1 APN 9 96048344 missense probably damaging 0.98
IGL01983:Xrn1 APN 9 95973368 critical splice donor site probably null
IGL02106:Xrn1 APN 9 95977805 missense probably benign 0.28
IGL02330:Xrn1 APN 9 95973348 nonsense probably null
IGL02338:Xrn1 APN 9 95977827 missense probably benign 0.42
IGL02830:Xrn1 APN 9 96018181 critical splice donor site probably null
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0467:Xrn1 UTSW 9 96024191 missense probably damaging 1.00
R0508:Xrn1 UTSW 9 96051736 missense probably benign 0.00
R0605:Xrn1 UTSW 9 96026877 nonsense probably null
R0670:Xrn1 UTSW 9 95991056 missense probably damaging 1.00
R0691:Xrn1 UTSW 9 95973539 missense probably damaging 0.96
R0781:Xrn1 UTSW 9 95991269 missense probably benign 0.00
R0947:Xrn1 UTSW 9 95998263 missense possibly damaging 0.60
R1034:Xrn1 UTSW 9 96039737 missense probably damaging 1.00
R1124:Xrn1 UTSW 9 96003865 missense probably benign 0.02
R1171:Xrn1 UTSW 9 95991011 missense possibly damaging 0.47
R1199:Xrn1 UTSW 9 95981761 splice site probably benign
R1609:Xrn1 UTSW 9 95974893 missense probably benign 0.03
R1921:Xrn1 UTSW 9 95999497 missense probably benign 0.04
R1953:Xrn1 UTSW 9 96024221 critical splice donor site probably null
R2000:Xrn1 UTSW 9 96045563 nonsense probably null
R2109:Xrn1 UTSW 9 95979220 missense probably benign 0.13
R2111:Xrn1 UTSW 9 96039832 missense probably benign 0.03
R2164:Xrn1 UTSW 9 96006820 missense possibly damaging 0.95
R2266:Xrn1 UTSW 9 96006712 missense possibly damaging 0.64
R3754:Xrn1 UTSW 9 95967788 missense probably damaging 1.00
R3783:Xrn1 UTSW 9 95969285 missense probably benign 0.10
R3921:Xrn1 UTSW 9 95969284 missense probably benign 0.01
R3929:Xrn1 UTSW 9 95988873 missense possibly damaging 0.89
R4011:Xrn1 UTSW 9 95985225 nonsense probably null
R4082:Xrn1 UTSW 9 95981920 missense probably benign 0.02
R4455:Xrn1 UTSW 9 95973645 intron probably benign
R4736:Xrn1 UTSW 9 96033636 missense probably damaging 1.00
R4780:Xrn1 UTSW 9 95974744 intron probably benign
R5152:Xrn1 UTSW 9 95964065 missense probably benign 0.40
R5261:Xrn1 UTSW 9 96045543 missense probably benign 0.00
R5741:Xrn1 UTSW 9 96045551 missense probably benign 0.24
R6108:Xrn1 UTSW 9 95974427 missense possibly damaging 0.91
R6127:Xrn1 UTSW 9 95969489 missense probably damaging 0.99
R6268:Xrn1 UTSW 9 95964014 missense probably damaging 1.00
R6418:Xrn1 UTSW 9 96033710 splice site probably null
R7002:Xrn1 UTSW 9 96047790 missense probably benign 0.00
R7067:Xrn1 UTSW 9 95969512 missense probably damaging 0.98
R7155:Xrn1 UTSW 9 95979145 missense possibly damaging 0.92
R7439:Xrn1 UTSW 9 96051629 missense probably benign
R7447:Xrn1 UTSW 9 96045494 missense probably benign
R7454:Xrn1 UTSW 9 96048358 missense probably benign 0.03
R7473:Xrn1 UTSW 9 95979141 missense probably benign 0.07
R7561:Xrn1 UTSW 9 95999458 missense probably benign 0.18
R7580:Xrn1 UTSW 9 96011679 missense not run
R7642:Xrn1 UTSW 9 96021853 missense possibly damaging 0.95
R7763:Xrn1 UTSW 9 95998348 critical splice donor site probably null
R8225:Xrn1 UTSW 9 96035667 missense probably benign
R8372:Xrn1 UTSW 9 96024113 missense probably benign 0.42
R8516:Xrn1 UTSW 9 96048391 nonsense probably null
R8710:Xrn1 UTSW 9 96002232 missense
R8850:Xrn1 UTSW 9 96038679 missense probably benign
R8865:Xrn1 UTSW 9 95991193 missense probably benign 0.00
R8951:Xrn1 UTSW 9 95988946 missense probably benign 0.00
Z1176:Xrn1 UTSW 9 95964190 missense probably damaging 1.00
Z1177:Xrn1 UTSW 9 95991005 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGCCACCTAAGTCTAACGTTTG -3'
(R):5'- TGAGCTACTTCCTAAGCCTCTAG -3'

Sequencing Primer
(F):5'- GCCACCTAAGTCTAACGTTTGTTCTC -3'
(R):5'- CTGTCTGGGACACAAACACTGG -3'
Posted On2015-11-11