Incidental Mutation 'R4756:Ramp3'
ID358030
Institutional Source Beutler Lab
Gene Symbol Ramp3
Ensembl Gene ENSMUSG00000041046
Gene Namereceptor (calcitonin) activity modifying protein 3
Synonyms
MMRRC Submission 041972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6658521-6677475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6674843 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 46 (M46L)
Ref Sequence ENSEMBL: ENSMUSP00000047518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045374]
Predicted Effect probably benign
Transcript: ENSMUST00000045374
AA Change: M46L

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047518
Gene: ENSMUSG00000041046
AA Change: M46L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:RAMP 36 145 1.3e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP3) protein, CRLR functions as an adrenomedullin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Ltbp1 A G 17: 75,225,204 D91G probably damaging Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Ramp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0730:Ramp3 UTSW 11 6676476 splice site probably benign
R1183:Ramp3 UTSW 11 6674867 missense possibly damaging 0.92
R2375:Ramp3 UTSW 11 6676643 missense probably benign 0.43
R4836:Ramp3 UTSW 11 6674761 critical splice acceptor site probably null
R5180:Ramp3 UTSW 11 6658619 missense unknown
R5312:Ramp3 UTSW 11 6674888 missense probably damaging 1.00
R6872:Ramp3 UTSW 11 6674768 missense possibly damaging 0.90
R8511:Ramp3 UTSW 11 6676709 missense probably benign 0.00
Z1177:Ramp3 UTSW 11 6676519 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGGGGCTATGCTTACATCAG -3'
(R):5'- ACAGCTCTATGTGGCTAAGC -3'

Sequencing Primer
(F):5'- GCTTACATCAGCAAGGGGTG -3'
(R):5'- GATACCCCTGCAGCTCAGAG -3'
Posted On2015-11-11