Incidental Mutation 'R0306:Il15'
ID35804
Institutional Source Beutler Lab
Gene Symbol Il15
Ensembl Gene ENSMUSG00000031712
Gene Nameinterleukin 15
Synonyms
MMRRC Submission 038517-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0306 (G1)
Quality Score99
Status Validated
Chromosome8
Chromosomal Location82331632-82403222 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 82334454 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034148] [ENSMUST00000209363] [ENSMUST00000209573] [ENSMUST00000211565]
Predicted Effect probably benign
Transcript: ENSMUST00000034148
SMART Domains Protein: ENSMUSP00000034148
Gene: ENSMUSG00000031712

DomainStartEndE-ValueType
Pfam:IL15 33 160 8.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209363
Predicted Effect probably benign
Transcript: ENSMUST00000209573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209687
Predicted Effect probably benign
Transcript: ENSMUST00000211565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211722
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: This gene encodes a a pleiotropic cytokine of the interleukin family of proteins that plays important roles in the innate and adaptive cell homeostasis, as well as peripheral immune function. The encoded protein undergoes proteolytic processing to generate a mature cytokine that stimulates the proliferation of natural killer cells. The transgenic mice overexpressing the encoded protein exhibit an increase in the number of memory CD8+ T cells in a naive state and enhanced protection against bacterial infections. Mice lacking the encoded protein exhibit impaired protection against a strain of attenuated Mycobacterium. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene have normal life spans but display a variety of immune system abnormalities and maternal placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,179,889 V270A probably damaging Het
BC028528 C T 3: 95,889,820 probably benign Het
Bspry T C 4: 62,496,157 F329S probably damaging Het
Cd209a A G 8: 3,745,535 Y120H probably benign Het
Ces1f T C 8: 93,276,544 probably benign Het
Cfap52 T C 11: 67,954,070 N58D probably benign Het
Cfap74 G A 4: 155,465,439 probably benign Het
Chst8 T C 7: 34,675,298 E372G probably benign Het
Ddx49 A G 8: 70,294,672 probably benign Het
Ddx52 G T 11: 83,944,648 L133F probably benign Het
Defb26 T A 2: 152,507,968 I131F unknown Het
Dip2c T A 13: 9,604,599 S719T probably benign Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Doxl2 T C 6: 48,976,086 V315A probably damaging Het
Dytn G A 1: 63,685,113 P3S possibly damaging Het
Fmn2 T C 1: 174,609,484 probably benign Het
Gal3st1 T A 11: 3,998,546 L251Q probably damaging Het
Gm19684 A T 17: 36,127,408 probably benign Het
Jag1 C T 2: 137,085,935 G852D probably damaging Het
Kbtbd4 A G 2: 90,914,186 probably benign Het
Kdm3b C A 18: 34,804,017 Q451K probably benign Het
Lrfn2 A T 17: 49,096,255 I469F probably damaging Het
Mep1a A T 17: 43,502,643 probably benign Het
Morn5 T C 2: 36,054,974 F70S probably damaging Het
Nav2 C A 7: 49,545,903 P1009Q probably benign Het
Noc3l T C 19: 38,807,650 Y334C probably damaging Het
Nsun4 A T 4: 116,052,822 Y180* probably null Het
Nup210l T C 3: 90,207,368 I1750T probably benign Het
Olfr1044 T A 2: 86,171,716 I34F possibly damaging Het
Olfr473 A T 7: 107,933,700 Y60F probably damaging Het
Olfr571 A T 7: 102,909,803 I12N probably benign Het
Parp14 A G 16: 35,856,574 L1008P probably benign Het
Paxbp1 A G 16: 91,022,115 V759A possibly damaging Het
Prdm10 C A 9: 31,316,224 Q42K probably damaging Het
Prkcsh T C 9: 22,006,526 probably benign Het
Psmg1 A G 16: 95,987,340 C138R probably damaging Het
Ptprb T C 10: 116,343,988 M1437T probably benign Het
Ryr3 A G 2: 112,775,655 probably null Het
Serpinf1 T C 11: 75,413,935 Y200C probably damaging Het
Shox2 T C 3: 66,973,834 H130R probably damaging Het
Slc22a1 A G 17: 12,662,598 F335L probably benign Het
Slc44a5 A G 3: 154,270,001 N683S probably damaging Het
Slc9a9 A T 9: 95,137,934 T519S probably benign Het
Smarca2 T A 19: 26,640,613 L348Q probably damaging Het
Sorbs1 T C 19: 40,344,411 D521G possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Srp19 T C 18: 34,334,576 probably benign Het
Stk35 T A 2: 129,801,763 Y222* probably null Het
Syt10 T G 15: 89,826,988 K114T probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Trpc4ap A G 2: 155,636,260 V662A probably benign Het
Ttll4 G A 1: 74,696,757 R1066Q probably benign Het
Tulp2 C T 7: 45,518,576 probably benign Het
Unc5b C A 10: 60,779,658 probably benign Het
Vmn1r230 T A 17: 20,846,633 I28K possibly damaging Het
Vmn2r118 A C 17: 55,608,616 F445V possibly damaging Het
Zfp142 C T 1: 74,570,182 E1485K probably damaging Het
Zfp819 C A 7: 43,617,197 A292E possibly damaging Het
Other mutations in Il15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Il15 APN 8 82343283 missense probably benign
R0638:Il15 UTSW 8 82343261 missense probably damaging 0.99
R0685:Il15 UTSW 8 82337559 splice site probably benign
R3012:Il15 UTSW 8 82344420 missense probably damaging 1.00
R7089:Il15 UTSW 8 82337575 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTCTAATGCCTTTGGCTGCAC -3'
(R):5'- GCCCAGTTGCAAAGTTACTGCAATG -3'

Sequencing Primer
(F):5'- TGTCTGTTTACCAAGGAGACC -3'
(R):5'- GCAAAGTTACTGCAATGAACTGC -3'
Posted On2013-05-09