Incidental Mutation 'R4756:Xdh'
ID 358051
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 041972-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R4756 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74193381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1305 (P1305L)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: P1305L

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: P1305L

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,336,830 (GRCm39) M45L probably benign Het
Acss2 T C 2: 155,403,063 (GRCm39) F627L probably damaging Het
Akap8 A G 17: 32,535,184 (GRCm39) S277P probably damaging Het
Akap9 T A 5: 4,051,418 (GRCm39) M1395K probably damaging Het
Ank1 A G 8: 23,612,893 (GRCm39) D1468G probably benign Het
Apoe A G 7: 19,430,846 (GRCm39) V121A probably benign Het
Aqp9 A T 9: 71,070,331 (GRCm39) L12H probably damaging Het
Atp2b4 G A 1: 133,639,529 (GRCm39) A1115V probably benign Het
Atp2b4 G A 1: 133,667,134 (GRCm39) P139L probably benign Het
B430218F22Rik T C 13: 118,523,980 (GRCm39) probably benign Het
Bltp2 T A 11: 78,154,854 (GRCm39) L122H probably damaging Het
Brsk1 A G 7: 4,711,866 (GRCm39) E572G possibly damaging Het
C6 T C 15: 4,811,394 (GRCm39) I414T probably benign Het
C8b T A 4: 104,644,083 (GRCm39) M250K probably benign Het
Camk1g T A 1: 193,044,393 (GRCm39) E7V probably benign Het
Clcc1 A G 3: 108,580,236 (GRCm39) probably null Het
Col4a3 G T 1: 82,694,018 (GRCm39) probably null Het
Cox5b T A 1: 36,732,310 (GRCm39) W104R probably damaging Het
Cyp2c55 A C 19: 39,019,815 (GRCm39) H251P probably damaging Het
Cyp2c67 G A 19: 39,632,188 (GRCm39) T60I probably benign Het
Defb42 T A 14: 63,285,824 (GRCm39) V68E probably benign Het
Ercc4 T A 16: 12,941,287 (GRCm39) I225N probably damaging Het
Fam120b G T 17: 15,622,658 (GRCm39) C212F probably damaging Het
Fgf10 T C 13: 118,918,045 (GRCm39) V111A probably benign Het
Fn1 G T 1: 71,629,967 (GRCm39) T2186K probably damaging Het
Fras1 T C 5: 96,929,518 (GRCm39) V3974A probably benign Het
Galnt4 T C 10: 98,944,362 (GRCm39) V29A probably benign Het
Gpr26 T C 7: 131,569,230 (GRCm39) Y192H probably damaging Het
Heatr9 A T 11: 83,407,475 (GRCm39) L236Q probably damaging Het
Hivep3 C A 4: 119,955,020 (GRCm39) P1112H probably damaging Het
Hnf4g A G 3: 3,708,069 (GRCm39) Y106C possibly damaging Het
Hnrnpdl A T 5: 100,185,783 (GRCm39) Y69* probably null Het
Itgb1 G A 8: 129,443,703 (GRCm39) A320T probably damaging Het
Kcna2 T C 3: 107,012,733 (GRCm39) I438T probably benign Het
Kif24 A G 4: 41,397,545 (GRCm39) probably null Het
Klhl1 G A 14: 96,389,402 (GRCm39) T584I probably benign Het
Ltbp1 A G 17: 75,532,199 (GRCm39) D91G probably damaging Het
Mdga2 T C 12: 66,844,427 (GRCm39) I190M probably damaging Het
Meis2 G A 2: 115,830,686 (GRCm39) R276C probably damaging Het
Mob4 C T 1: 55,191,855 (GRCm39) R190W probably damaging Het
Mrgpra2a A G 7: 47,077,114 (GRCm39) I48T possibly damaging Het
Mst1 T C 9: 107,960,826 (GRCm39) V481A probably benign Het
Mttp A T 3: 137,821,832 (GRCm39) V245E possibly damaging Het
Nbn T A 4: 15,981,470 (GRCm39) S521T probably benign Het
Neb G T 2: 52,083,243 (GRCm39) T5654N probably damaging Het
Nlrp9a A T 7: 26,256,866 (GRCm39) K161N probably damaging Het
Nod2 T G 8: 89,390,902 (GRCm39) F388C possibly damaging Het
Or3a1 G T 11: 74,225,402 (GRCm39) F218L probably benign Het
Or4a75 G T 2: 89,447,814 (GRCm39) H241N possibly damaging Het
Or4f58 A G 2: 111,851,332 (GRCm39) F289S possibly damaging Het
Or52e2 A T 7: 102,804,332 (GRCm39) N207K probably benign Het
Or7a38 T A 10: 78,753,361 (GRCm39) I229N probably damaging Het
Or7g25 G A 9: 19,160,153 (GRCm39) L181F possibly damaging Het
P2ry1 A G 3: 60,911,898 (GRCm39) S346G probably benign Het
Polr1f T A 12: 33,487,679 (GRCm39) probably null Het
Prkcd A G 14: 30,321,623 (GRCm39) F524L probably benign Het
Qrfprl T C 6: 65,429,898 (GRCm39) I198T probably benign Het
Ramp3 A T 11: 6,624,843 (GRCm39) M46L probably benign Het
Rint1 T C 5: 24,014,791 (GRCm39) Y278H probably damaging Het
Skint11 C T 4: 114,051,874 (GRCm39) T74I probably benign Het
Slc10a7 T C 8: 79,433,579 (GRCm39) probably null Het
Slc45a2 T A 15: 11,028,016 (GRCm39) Y528* probably null Het
Slit1 A G 19: 41,637,452 (GRCm39) F329L probably damaging Het
Sltm A T 9: 70,498,892 (GRCm39) M989L possibly damaging Het
Smad9 A T 3: 54,701,874 (GRCm39) T372S possibly damaging Het
Snrpc T A 17: 28,061,306 (GRCm39) Y38* probably null Het
Spag17 A G 3: 100,010,701 (GRCm39) K2065R possibly damaging Het
Stxbp4 T A 11: 90,498,197 (GRCm39) K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,019,258 (GRCm39) probably null Het
Tgfb1i1 A T 7: 127,848,571 (GRCm39) M96L probably damaging Het
Tnc T A 4: 63,885,580 (GRCm39) I1841F probably damaging Het
Ubap2 G T 4: 41,211,771 (GRCm39) H63Q probably damaging Het
Vps13a T C 19: 16,632,580 (GRCm39) N2592S probably benign Het
Xrn1 G A 9: 95,921,862 (GRCm39) R1425K probably benign Het
Zfp418 G A 7: 7,185,762 (GRCm39) R575Q possibly damaging Het
Zfp608 T A 18: 55,027,544 (GRCm39) Q1424H probably damaging Het
Zfp839 C A 12: 110,821,635 (GRCm39) L150I possibly damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAAGCGATCCTTGACC -3'
(R):5'- TATCTCAGTGCAGGGCTCATGG -3'

Sequencing Primer
(F):5'- TTGACCCCAAGGCCAGC -3'
(R):5'- CCTCCTGGGTCAGTGTGATG -3'
Posted On 2015-11-11