Incidental Mutation 'R4756:Ltbp1'
ID358052
Institutional Source Beutler Lab
Gene Symbol Ltbp1
Ensembl Gene ENSMUSG00000001870
Gene Namelatent transforming growth factor beta binding protein 1
Synonymsb2b1000Clo, LTBP-1, 9430031G15Rik
MMRRC Submission 041972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4756 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location75005568-75392512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75225204 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000108135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001927] [ENSMUST00000112514] [ENSMUST00000112516] [ENSMUST00000135447]
Predicted Effect probably damaging
Transcript: ENSMUST00000001927
AA Change: D409G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001927
Gene: ENSMUSG00000001870
AA Change: D409G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 34 49 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
low complexity region 94 109 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
EGF 184 213 9.27e-1 SMART
EGF 394 423 2.23e-3 SMART
Pfam:TB 559 601 2.4e-9 PFAM
EGF_CA 618 658 9.39e-11 SMART
Pfam:TB 680 720 1e-18 PFAM
low complexity region 839 849 N/A INTRINSIC
EGF_CA 865 906 5.83e-7 SMART
EGF_CA 907 948 6.39e-13 SMART
EGF_CA 949 989 4.25e-9 SMART
EGF_CA 990 1029 2.44e-9 SMART
EGF_CA 1030 1070 5.87e-12 SMART
EGF_CA 1071 1111 3.61e-12 SMART
EGF_CA 1112 1152 1.57e-12 SMART
EGF_CA 1153 1193 1.75e-10 SMART
EGF_CA 1194 1235 6.74e-12 SMART
EGF_CA 1236 1277 3.22e-9 SMART
EGF 1281 1320 2.16e1 SMART
Pfam:TB 1349 1391 5.6e-17 PFAM
EGF 1418 1457 1.14e0 SMART
EGF_CA 1458 1498 2.68e-6 SMART
Pfam:TB 1526 1567 4.2e-15 PFAM
EGF 1615 1652 1e-5 SMART
EGF_CA 1653 1697 5.11e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112514
AA Change: D91G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108133
Gene: ENSMUSG00000001870
AA Change: D91G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.5e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 400 3.1e-17 PFAM
low complexity region 468 478 N/A INTRINSIC
EGF_CA 494 535 5.83e-7 SMART
EGF_CA 536 577 6.39e-13 SMART
EGF_CA 578 618 4.25e-9 SMART
EGF_CA 619 658 2.44e-9 SMART
EGF_CA 659 699 5.87e-12 SMART
EGF_CA 700 740 3.61e-12 SMART
EGF_CA 741 781 1.57e-12 SMART
EGF_CA 782 822 1.75e-10 SMART
EGF_CA 823 864 6.74e-12 SMART
EGF_CA 865 906 3.22e-9 SMART
EGF 910 949 2.16e1 SMART
Pfam:TB 977 1020 4.3e-20 PFAM
EGF 1047 1086 1.14e0 SMART
EGF_CA 1087 1127 2.68e-6 SMART
Pfam:TB 1154 1196 1.3e-17 PFAM
EGF 1244 1281 1e-5 SMART
EGF_CA 1282 1326 5.11e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112516
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108135
Gene: ENSMUSG00000001870
AA Change: D91G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.9e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 402 7.6e-20 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 5.83e-7 SMART
EGF_CA 589 630 6.39e-13 SMART
EGF_CA 631 671 4.25e-9 SMART
EGF_CA 672 711 2.44e-9 SMART
EGF_CA 712 752 5.87e-12 SMART
EGF_CA 753 793 3.61e-12 SMART
EGF_CA 794 834 1.57e-12 SMART
EGF_CA 835 875 1.75e-10 SMART
EGF_CA 876 917 6.74e-12 SMART
EGF_CA 918 959 3.22e-9 SMART
EGF 963 1002 2.16e1 SMART
Pfam:TB 1030 1073 4.5e-20 PFAM
EGF 1100 1139 1.14e0 SMART
EGF_CA 1140 1180 2.68e-6 SMART
Pfam:TB 1207 1249 1.4e-17 PFAM
EGF 1297 1334 1e-5 SMART
EGF_CA 1335 1379 5.11e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135447
AA Change: D91G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116890
Gene: ENSMUSG00000001870
AA Change: D91G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 1.1e-5 SMART
Pfam:TB 240 283 4.3e-10 PFAM
EGF_CA 300 340 4.4e-13 SMART
Pfam:TB 361 402 3.3e-17 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 2.9e-9 SMART
EGF_CA 589 630 3e-15 SMART
EGF_CA 631 671 2.1e-11 SMART
EGF_CA 672 711 1.2e-11 SMART
EGF_CA 712 752 2.8e-14 SMART
EGF_CA 753 793 1.8e-14 SMART
EGF_CA 794 834 7.5e-15 SMART
EGF_CA 835 875 8.4e-13 SMART
EGF_CA 876 917 3.2e-14 SMART
EGF_CA 918 959 1.6e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent TGF-beta binding proteins (LTBPs). The secretion and activation of TGF-betas is regulated by their association with latency-associated proteins and with latent TGF-beta binding proteins. The product of this gene targets latent complexes of transforming growth factor beta to the extracellular matrix, where the latent cytokine is subsequently activated by several different mechanisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality associated with defects in the aortic arch and outflow tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,264,028 L122H probably damaging Het
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
Acss2 T C 2: 155,561,143 F627L probably damaging Het
Akap8 A G 17: 32,316,210 S277P probably damaging Het
Akap9 T A 5: 4,001,418 M1395K probably damaging Het
Ank1 A G 8: 23,122,877 D1468G probably benign Het
Apoe A G 7: 19,696,921 V121A probably benign Het
Aqp9 A T 9: 71,163,049 L12H probably damaging Het
Atp2b4 G A 1: 133,711,791 A1115V probably benign Het
Atp2b4 G A 1: 133,739,396 P139L probably benign Het
B430218F22Rik T C 13: 118,387,444 probably benign Het
Brsk1 A G 7: 4,708,867 E572G possibly damaging Het
C130060K24Rik T C 6: 65,452,914 I198T probably benign Het
C6 T C 15: 4,781,912 I414T probably benign Het
C8b T A 4: 104,786,886 M250K probably benign Het
Camk1g T A 1: 193,362,085 E7V probably benign Het
Clcc1 A G 3: 108,672,920 probably null Het
Col4a3 G T 1: 82,716,297 probably null Het
Cox5b T A 1: 36,693,229 W104R probably damaging Het
Cyp2c55 A C 19: 39,031,371 H251P probably damaging Het
Cyp2c67 G A 19: 39,643,744 T60I probably benign Het
Defb42 T A 14: 63,048,375 V68E probably benign Het
Ercc4 T A 16: 13,123,423 I225N probably damaging Het
Fam120b G T 17: 15,402,396 C212F probably damaging Het
Fgf10 T C 13: 118,781,509 V111A probably benign Het
Fn1 G T 1: 71,590,808 T2186K probably damaging Het
Fras1 T C 5: 96,781,659 V3974A probably benign Het
Galnt4 T C 10: 99,108,500 V29A probably benign Het
Gpr26 T C 7: 131,967,501 Y192H probably damaging Het
Heatr9 A T 11: 83,516,649 L236Q probably damaging Het
Hivep3 C A 4: 120,097,823 P1112H probably damaging Het
Hnf4g A G 3: 3,643,009 Y106C possibly damaging Het
Hnrnpdl A T 5: 100,037,924 Y69* probably null Het
Itgb1 G A 8: 128,717,222 A320T probably damaging Het
Kcna2 T C 3: 107,105,417 I438T probably benign Het
Kif24 A G 4: 41,397,545 probably null Het
Klhl1 G A 14: 96,151,966 T584I probably benign Het
Mdga2 T C 12: 66,797,653 I190M probably damaging Het
Meis2 G A 2: 116,000,205 R276C probably damaging Het
Mob4 C T 1: 55,152,696 R190W probably damaging Het
Mrgpra2a A G 7: 47,427,366 I48T possibly damaging Het
Mst1 T C 9: 108,083,627 V481A probably benign Het
Mttp A T 3: 138,116,071 V245E possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Neb G T 2: 52,193,231 T5654N probably damaging Het
Nlrp9a A T 7: 26,557,441 K161N probably damaging Het
Nod2 T G 8: 88,664,274 F388C possibly damaging Het
Olfr1248 G T 2: 89,617,470 H241N possibly damaging Het
Olfr1311 A G 2: 112,020,987 F289S possibly damaging Het
Olfr1354 T A 10: 78,917,527 I229N probably damaging Het
Olfr410 G T 11: 74,334,576 F218L probably benign Het
Olfr589 A T 7: 103,155,125 N207K probably benign Het
Olfr843 G A 9: 19,248,857 L181F possibly damaging Het
P2ry1 A G 3: 61,004,477 S346G probably benign Het
Prkcd A G 14: 30,599,666 F524L probably benign Het
Ramp3 A T 11: 6,674,843 M46L probably benign Het
Rint1 T C 5: 23,809,793 Y278H probably damaging Het
Skint11 C T 4: 114,194,677 T74I probably benign Het
Slc10a7 T C 8: 78,706,950 probably null Het
Slc45a2 T A 15: 11,027,930 Y528* probably null Het
Slit1 A G 19: 41,649,013 F329L probably damaging Het
Sltm A T 9: 70,591,610 M989L possibly damaging Het
Smad9 A T 3: 54,794,453 T372S possibly damaging Het
Snrpc T A 17: 27,842,332 Y38* probably null Het
Spag17 A G 3: 100,103,385 K2065R possibly damaging Het
Stxbp4 T A 11: 90,607,371 K87N probably damaging Het
Tbc1d23 AT ATT 16: 57,198,895 probably null Het
Tgfb1i1 A T 7: 128,249,399 M96L probably damaging Het
Tnc T A 4: 63,967,343 I1841F probably damaging Het
Twistnb T A 12: 33,437,680 probably null Het
Ubap2 G T 4: 41,211,771 H63Q probably damaging Het
Vps13a T C 19: 16,655,216 N2592S probably benign Het
Xdh G A 17: 73,886,386 P1305L probably benign Het
Xrn1 G A 9: 96,039,809 R1425K probably benign Het
Zfp418 G A 7: 7,182,763 R575Q possibly damaging Het
Zfp608 T A 18: 54,894,472 Q1424H probably damaging Het
Zfp839 C A 12: 110,855,201 L150I possibly damaging Het
Other mutations in Ltbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ltbp1 APN 17 75225338 missense probably damaging 1.00
IGL00156:Ltbp1 APN 17 75385160 missense probably damaging 0.97
IGL00161:Ltbp1 APN 17 75310152 splice site probably benign
IGL00771:Ltbp1 APN 17 75362516 missense probably damaging 1.00
IGL00822:Ltbp1 APN 17 75151321 missense probably damaging 1.00
IGL01760:Ltbp1 APN 17 75227150 missense probably damaging 0.97
IGL01796:Ltbp1 APN 17 75227245 splice site probably benign
IGL01826:Ltbp1 APN 17 75292840 missense possibly damaging 0.67
IGL02372:Ltbp1 APN 17 75252406 missense probably damaging 0.99
IGL02792:Ltbp1 APN 17 75282994 missense probably damaging 1.00
IGL02862:Ltbp1 APN 17 75390471 missense probably damaging 1.00
IGL03095:Ltbp1 APN 17 75282418 missense possibly damaging 0.67
IGL03345:Ltbp1 APN 17 75066159 missense probably damaging 0.99
IGL03404:Ltbp1 APN 17 75225306 missense probably damaging 0.97
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0034:Ltbp1 UTSW 17 75047568 intron probably benign
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0467:Ltbp1 UTSW 17 75282429 critical splice donor site probably null
R0554:Ltbp1 UTSW 17 75225279 missense probably damaging 0.99
R0584:Ltbp1 UTSW 17 75363472 missense probably damaging 1.00
R0863:Ltbp1 UTSW 17 75252386 missense probably damaging 1.00
R0991:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1084:Ltbp1 UTSW 17 75359425 nonsense probably null
R1114:Ltbp1 UTSW 17 75360775 missense probably benign
R1177:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1179:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1245:Ltbp1 UTSW 17 75327194 splice site probably benign
R1246:Ltbp1 UTSW 17 75385161 nonsense probably null
R1258:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1259:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1260:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1262:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1265:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1267:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1269:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1272:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1411:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1579:Ltbp1 UTSW 17 75252367 missense probably benign 0.00
R1694:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1705:Ltbp1 UTSW 17 75385201 splice site probably null
R1716:Ltbp1 UTSW 17 75315024 missense probably benign 0.08
R1815:Ltbp1 UTSW 17 75252380 missense probably benign 0.00
R1932:Ltbp1 UTSW 17 75313034 missense probably benign 0.01
R1951:Ltbp1 UTSW 17 75151377 missense probably benign 0.00
R2044:Ltbp1 UTSW 17 75276432 missense probably damaging 1.00
R2118:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2120:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2121:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2122:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2171:Ltbp1 UTSW 17 75291317 missense probably damaging 0.99
R2237:Ltbp1 UTSW 17 75310163 missense probably benign 0.31
R2655:Ltbp1 UTSW 17 75005983 missense possibly damaging 0.76
R2941:Ltbp1 UTSW 17 75179093 missense probably damaging 1.00
R3177:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3177:Ltbp1 UTSW 17 75359278 splice site probably null
R3277:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3277:Ltbp1 UTSW 17 75359278 splice site probably null
R3797:Ltbp1 UTSW 17 75362630 missense probably damaging 1.00
R3861:Ltbp1 UTSW 17 75359338 missense possibly damaging 0.93
R3897:Ltbp1 UTSW 17 75274016 missense probably damaging 1.00
R4002:Ltbp1 UTSW 17 75310159 missense probably benign 0.09
R4057:Ltbp1 UTSW 17 75310194 missense probably damaging 1.00
R4261:Ltbp1 UTSW 17 75291367 nonsense probably null
R4375:Ltbp1 UTSW 17 75312997 missense probably damaging 1.00
R4458:Ltbp1 UTSW 17 75276507 missense possibly damaging 0.96
R4519:Ltbp1 UTSW 17 75364497 missense probably benign 0.14
R4529:Ltbp1 UTSW 17 75151360 missense probably benign 0.21
R4614:Ltbp1 UTSW 17 75289994 intron probably benign
R4724:Ltbp1 UTSW 17 75313008 missense probably damaging 0.99
R4907:Ltbp1 UTSW 17 75005904 missense probably benign
R4910:Ltbp1 UTSW 17 75327292 missense probably damaging 1.00
R4976:Ltbp1 UTSW 17 75321095 critical splice donor site probably null
R5011:Ltbp1 UTSW 17 75066157 missense probably damaging 0.99
R5047:Ltbp1 UTSW 17 75292886 splice site probably benign
R5259:Ltbp1 UTSW 17 75363362 missense probably benign 0.03
R5438:Ltbp1 UTSW 17 75291326 missense probably damaging 0.98
R5583:Ltbp1 UTSW 17 75291330 missense probably benign 0.00
R5757:Ltbp1 UTSW 17 75273949 splice site probably null
R5950:Ltbp1 UTSW 17 75273870 missense probably damaging 1.00
R5976:Ltbp1 UTSW 17 75290083 missense probably damaging 1.00
R6267:Ltbp1 UTSW 17 75005989 missense possibly damaging 0.70
R6383:Ltbp1 UTSW 17 75359457 missense probably damaging 0.99
R6400:Ltbp1 UTSW 17 75151402 missense possibly damaging 0.62
R6861:Ltbp1 UTSW 17 75227192 missense possibly damaging 0.76
R6880:Ltbp1 UTSW 17 75321049 missense possibly damaging 0.77
R7168:Ltbp1 UTSW 17 75291366 missense probably damaging 1.00
R7198:Ltbp1 UTSW 17 75226967 missense possibly damaging 0.94
R7260:Ltbp1 UTSW 17 75066144 missense probably benign 0.01
R7262:Ltbp1 UTSW 17 75364368 missense probably damaging 1.00
R7340:Ltbp1 UTSW 17 75327228 nonsense probably null
R7443:Ltbp1 UTSW 17 75364437 missense probably damaging 1.00
R7510:Ltbp1 UTSW 17 75352717 missense probably damaging 1.00
R7676:Ltbp1 UTSW 17 75291297 missense possibly damaging 0.58
R7717:Ltbp1 UTSW 17 75290078 missense possibly damaging 0.90
R7720:Ltbp1 UTSW 17 75385124 missense probably damaging 1.00
R7799:Ltbp1 UTSW 17 75252356 missense probably damaging 0.99
R7944:Ltbp1 UTSW 17 75390551 makesense probably null
R7945:Ltbp1 UTSW 17 75390551 makesense probably null
R7976:Ltbp1 UTSW 17 75363363 missense possibly damaging 0.94
R8256:Ltbp1 UTSW 17 75315241 intron probably benign
R8295:Ltbp1 UTSW 17 75179189 missense probably benign 0.10
R8423:Ltbp1 UTSW 17 75292857 missense probably benign
R8462:Ltbp1 UTSW 17 75313074 missense probably damaging 1.00
R8677:Ltbp1 UTSW 17 75348758 missense probably benign 0.00
R8742:Ltbp1 UTSW 17 75310222 missense probably damaging 0.99
R8766:Ltbp1 UTSW 17 75296255 nonsense probably null
R8873:Ltbp1 UTSW 17 75179177 missense probably damaging 1.00
R8887:Ltbp1 UTSW 17 75179082 missense probably damaging 1.00
X0001:Ltbp1 UTSW 17 75227178 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACATTCAGGCAAATGTAGTCATGG -3'
(R):5'- TTTGACCCCTTGCTGGCTAG -3'

Sequencing Primer
(F):5'- CTTGTTCATGCCAGAAGAAACAG -3'
(R):5'- GACCCCTTGCTGGCTAGTCATG -3'
Posted On2015-11-11