Incidental Mutation 'R4741:Secisbp2l'
ID358064
Institutional Source Beutler Lab
Gene Symbol Secisbp2l
Ensembl Gene ENSMUSG00000035093
Gene NameSECIS binding protein 2-like
Synonyms3110001I20Rik
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125736986-125782870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125740737 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 933 (G933D)
Ref Sequence ENSEMBL: ENSMUSP00000055772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053699
AA Change: G933D

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: G933D

DomainStartEndE-ValueType
low complexity region 441 459 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 700 802 7.6e-24 PFAM
low complexity region 821 831 N/A INTRINSIC
low complexity region 970 978 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139944
SMART Domains Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 326 427 3.5e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Secisbp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Secisbp2l APN 2 125743856 missense probably damaging 0.99
IGL00644:Secisbp2l APN 2 125743844 missense probably damaging 1.00
IGL01093:Secisbp2l APN 2 125740325 missense probably benign
IGL01621:Secisbp2l APN 2 125773211 missense probably benign
IGL01955:Secisbp2l APN 2 125743812 critical splice donor site probably null
IGL02036:Secisbp2l APN 2 125758207 missense probably benign
IGL02045:Secisbp2l APN 2 125775578 missense possibly damaging 0.82
IGL02182:Secisbp2l APN 2 125747577 missense probably damaging 1.00
IGL02408:Secisbp2l APN 2 125740869 nonsense probably null
IGL02455:Secisbp2l APN 2 125773478 missense possibly damaging 0.89
IGL02953:Secisbp2l APN 2 125760274 missense probably benign 0.36
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R1415:Secisbp2l UTSW 2 125740365 missense probably benign 0.00
R1626:Secisbp2l UTSW 2 125775686 missense probably damaging 0.99
R1926:Secisbp2l UTSW 2 125740677 missense probably damaging 0.99
R1940:Secisbp2l UTSW 2 125740339 missense probably damaging 1.00
R1970:Secisbp2l UTSW 2 125747510 missense probably damaging 1.00
R2100:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2240:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2252:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2253:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2472:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2474:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2475:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2990:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2993:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3113:Secisbp2l UTSW 2 125750286 missense probably damaging 1.00
R3696:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3750:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3800:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3810:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3812:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3815:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3816:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3817:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3880:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4077:Secisbp2l UTSW 2 125751865 splice site probably benign
R4096:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4097:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4164:Secisbp2l UTSW 2 125751883 intron probably benign
R4332:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4418:Secisbp2l UTSW 2 125752915 missense probably benign 0.00
R4598:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4600:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4602:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4603:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4678:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4679:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4684:Secisbp2l UTSW 2 125745942 missense probably damaging 1.00
R4749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4934:Secisbp2l UTSW 2 125740489 missense probably damaging 0.99
R5245:Secisbp2l UTSW 2 125747591 missense probably damaging 1.00
R5521:Secisbp2l UTSW 2 125752977 missense possibly damaging 0.94
R5547:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5630:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5631:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5632:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6378:Secisbp2l UTSW 2 125768325 missense possibly damaging 0.78
R6616:Secisbp2l UTSW 2 125768226 missense probably damaging 0.96
R6938:Secisbp2l UTSW 2 125750352 missense probably damaging 1.00
R7287:Secisbp2l UTSW 2 125740369 missense probably benign
R7373:Secisbp2l UTSW 2 125757271 missense probably damaging 0.99
R7403:Secisbp2l UTSW 2 125760279 missense possibly damaging 0.73
R7484:Secisbp2l UTSW 2 125771532 nonsense probably null
R7504:Secisbp2l UTSW 2 125758171 missense probably benign 0.30
R7762:Secisbp2l UTSW 2 125768193 missense probably damaging 1.00
R7769:Secisbp2l UTSW 2 125771545 critical splice acceptor site probably benign
R8018:Secisbp2l UTSW 2 125745909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCTGTGGGCTCATGAC -3'
(R):5'- CTTGTAGAGACTAACTGGAGGAGC -3'

Sequencing Primer
(F):5'- GCTGTGGGCTCATGACTATAATCC -3'
(R):5'- AGCATGGTGGAGACGTCC -3'
Posted On2015-11-11