Incidental Mutation 'R4741:Jmjd1c'
ID358093
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67224939 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 737 (I737V)
Ref Sequence ENSEMBL: ENSMUSP00000134246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174317] [ENSMUST00000174408]
Predicted Effect probably benign
Transcript: ENSMUST00000051446
AA Change: I1024V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: I1024V

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173689
AA Change: I843V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: I843V

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174317
AA Change: I737V

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134246
Gene: ENSMUSG00000037876
AA Change: I737V

DomainStartEndE-ValueType
Blast:JmjC 1 744 N/A BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174408
AA Change: I1024V

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: I1024V

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Doc2a A T 7: 126,851,445 T298S possibly damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense probably damaging 0.99
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTCTAATGCATCCACATCAG -3'
(R):5'- TCTTGGTGGCTCATTGACCAC -3'

Sequencing Primer
(F):5'- TCCACATCAGTAAAAGGTGACCTGG -3'
(R):5'- AGTTACTCTGGGGCAAACTC -3'
Posted On2015-11-11