Incidental Mutation 'R4742:Col9a3'
ID358120
Institutional Source Beutler Lab
Gene Symbol Col9a3
Ensembl Gene ENSMUSG00000027570
Gene Namecollagen, type IX, alpha 3
Synonyms
MMRRC Submission 041966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R4742 (G1)
Quality Score191
Status Validated
Chromosome2
Chromosomal Location180597790-180622189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 180603387 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 130 (G130W)
Ref Sequence ENSEMBL: ENSMUSP00000128718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103059] [ENSMUST00000132527]
Predicted Effect unknown
Transcript: ENSMUST00000103059
AA Change: G130W
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570
AA Change: G130W

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129090
Predicted Effect unknown
Transcript: ENSMUST00000132527
AA Change: G130W
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570
AA Change: G130W

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141056
Meta Mutation Damage Score 0.2751 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
8030423J24Rik G T 13: 70,883,525 R17L unknown Het
Acan T C 7: 79,100,769 F1763L probably benign Het
Adgrb1 T A 15: 74,529,479 L108* probably null Het
Anapc2 T A 2: 25,273,543 probably null Het
Apbb1ip A G 2: 22,826,916 K177E unknown Het
Azgp1 T A 5: 137,989,626 Y223* probably null Het
BC005561 A T 5: 104,518,857 N415I probably benign Het
Cfap44 T G 16: 44,449,252 probably null Het
Chfr C T 5: 110,143,598 T94I probably benign Het
Chrna10 T G 7: 102,113,137 Q282P probably damaging Het
Dcaf1 A G 9: 106,858,555 T901A probably benign Het
Dock2 T G 11: 34,294,170 probably null Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam160a2 A G 7: 105,384,311 V566A probably damaging Het
Fdxacb1 A G 9: 50,768,668 probably benign Het
Il31ra G T 13: 112,523,967 S615* probably null Het
Itgam C T 7: 128,113,073 S827F probably damaging Het
Mapkbp1 T A 2: 120,016,818 V512E probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nab2 T C 10: 127,662,827 T458A probably benign Het
Nadsyn1 A G 7: 143,798,630 probably benign Het
Nek10 A G 14: 14,861,624 D560G probably null Het
Olfr319 A G 11: 58,701,859 R53G probably benign Het
Olfr695 A T 7: 106,873,428 N272K probably damaging Het
Olfr910 T C 9: 38,539,656 S254P probably damaging Het
Park2 T A 17: 11,237,704 probably null Het
Pou1f1 C A 16: 65,523,481 P19T probably benign Het
Prdm9 A T 17: 15,553,521 D329E probably damaging Het
Ptprm A C 17: 66,744,751 Y962* probably null Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rtkn2 A G 10: 68,003,314 T154A possibly damaging Het
Slitrk3 T C 3: 73,048,565 D958G probably benign Het
Spata31d1b C A 13: 59,716,612 H525N probably damaging Het
Tacc2 A G 7: 130,625,967 R1461G probably benign Het
Tas2r105 G A 6: 131,686,851 H205Y probably damaging Het
Tenm4 A G 7: 96,797,484 N809D probably damaging Het
Tns1 A G 1: 74,124,290 probably null Het
Top1 A G 2: 160,703,570 probably null Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Txndc9 T C 1: 37,987,684 D135G possibly damaging Het
Usp3 A G 9: 66,520,677 Y339H probably damaging Het
Vmn1r5 A T 6: 56,986,251 K304* probably null Het
Vmn2r92 A G 17: 18,166,857 T153A probably benign Het
Xkr5 A T 8: 18,948,730 *55K probably null Het
Other mutations in Col9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Col9a3 APN 2 180616434 missense probably damaging 0.96
IGL01542:Col9a3 APN 2 180609316 splice site probably benign
IGL01727:Col9a3 APN 2 180616565 critical splice donor site probably null
IGL02558:Col9a3 APN 2 180606806 critical splice acceptor site probably null
IGL03112:Col9a3 APN 2 180607642 missense possibly damaging 0.60
IGL02796:Col9a3 UTSW 2 180614162 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0477:Col9a3 UTSW 2 180609470 splice site probably benign
R0890:Col9a3 UTSW 2 180610063 missense probably benign 0.23
R1934:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R4355:Col9a3 UTSW 2 180606478 missense probably benign 0.00
R4571:Col9a3 UTSW 2 180616366 splice site probably benign
R4688:Col9a3 UTSW 2 180607631 missense probably damaging 0.99
R4731:Col9a3 UTSW 2 180610681 missense probably damaging 0.99
R4847:Col9a3 UTSW 2 180615525 missense probably damaging 1.00
R4985:Col9a3 UTSW 2 180603400 missense unknown
R5488:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5489:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5573:Col9a3 UTSW 2 180619732 missense probably benign 0.17
R5575:Col9a3 UTSW 2 180598846 intron probably benign
R6820:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R7114:Col9a3 UTSW 2 180603797 missense unknown
R7710:Col9a3 UTSW 2 180609365 missense probably damaging 0.98
R8177:Col9a3 UTSW 2 180607657 missense probably damaging 0.97
R8342:Col9a3 UTSW 2 180603390 missense unknown
Predicted Primers PCR Primer
(F):5'- AATAGCCCAGATCGTGGTGG -3'
(R):5'- TGTCTGCCACCCTGAGTCATAG -3'

Sequencing Primer
(F):5'- GAGTGGTCTCCTTAGGGGACATC -3'
(R):5'- AGTCATAGGCGGCTCTCTGTC -3'
Posted On2015-11-11