Mutagenetix > Incidental Mutations

Incidental Mutation 'R4742:Chfr'

358123

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

041966-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R4742 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 110143598 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 94 (T94I)

Ref Sequence

ENSEMBL: ENSMUSP00000143480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199283] [ENSMUST00000199557] [ENSMUST00000199672] [ENSMUST00000199811]

AlphaFold

Q810L3

Predicted Effect

probably benign
Transcript: ENSMUST00000014812
AA Change: T94I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: T94I

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112519
AA Change: T94I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: T94I

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197010

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

probably benign
Transcript: ENSMUST00000198633
AA Change: T94I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: T94I

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199283

SMART Domains

Protein: ENSMUSP00000143389
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	50	7e-6	SMART
PDB:1LGQ\|B	16	50	8e-12	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199672

Predicted Effect

probably benign
Transcript: ENSMUST00000199811
AA Change: T94I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000143737
Gene: ENSMUSG00000014668
AA Change: T94I

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	5.3e-9	SMART

Meta Mutation Damage Score

0.1461

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,578,381	I139V	probably benign	Het
8030423J24Rik	G	T	13: 70,883,525	R17L	unknown	Het
Acan	T	C	7: 79,100,769	F1763L	probably benign	Het
Adgrb1	T	A	15: 74,529,479	L108*	probably null	Het
Anapc2	T	A	2: 25,273,543		probably null	Het
Apbb1ip	A	G	2: 22,826,916	K177E	unknown	Het
Azgp1	T	A	5: 137,989,626	Y223*	probably null	Het
BC005561	A	T	5: 104,518,857	N415I	probably benign	Het
Cfap44	T	G	16: 44,449,252		probably null	Het
Chrna10	T	G	7: 102,113,137	Q282P	probably damaging	Het
Col9a3	G	T	2: 180,603,387	G130W	unknown	Het
Dcaf1	A	G	9: 106,858,555	T901A	probably benign	Het
Dock2	T	G	11: 34,294,170		probably null	Het
Dysf	C	A	6: 84,097,715	D499E	probably damaging	Het
Fam160a2	A	G	7: 105,384,311	V566A	probably damaging	Het
Fdxacb1	A	G	9: 50,768,668		probably benign	Het
Il31ra	G	T	13: 112,523,967	S615*	probably null	Het
Itgam	C	T	7: 128,113,073	S827F	probably damaging	Het
Mapkbp1	T	A	2: 120,016,818	V512E	probably damaging	Het
Myo1c	C	T	11: 75,670,030	R770*	probably null	Het
Nab2	T	C	10: 127,662,827	T458A	probably benign	Het
Nadsyn1	A	G	7: 143,798,630		probably benign	Het
Nek10	A	G	14: 14,861,624	D560G	probably null	Het
Olfr319	A	G	11: 58,701,859	R53G	probably benign	Het
Olfr695	A	T	7: 106,873,428	N272K	probably damaging	Het
Olfr910	T	C	9: 38,539,656	S254P	probably damaging	Het
Park2	T	A	17: 11,237,704		probably null	Het
Pou1f1	C	A	16: 65,523,481	P19T	probably benign	Het
Prdm9	A	T	17: 15,553,521	D329E	probably damaging	Het
Ptprm	A	C	17: 66,744,751	Y962*	probably null	Het
Rad9a	G	A	19: 4,200,561	R85C	probably damaging	Het
Rhox2c	A	C	X: 37,453,698	Q4H	probably benign	Het
Rtkn2	A	G	10: 68,003,314	T154A	possibly damaging	Het
Slitrk3	T	C	3: 73,048,565	D958G	probably benign	Het
Spata31d1b	C	A	13: 59,716,612	H525N	probably damaging	Het
Tacc2	A	G	7: 130,625,967	R1461G	probably benign	Het
Tas2r105	G	A	6: 131,686,851	H205Y	probably damaging	Het
Tenm4	A	G	7: 96,797,484	N809D	probably damaging	Het
Tns1	A	G	1: 74,124,290		probably null	Het
Top1	A	G	2: 160,703,570		probably null	Het
Traf3ip2	C	T	10: 39,639,260	P345S	possibly damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Txndc9	T	C	1: 37,987,684	D135G	possibly damaging	Het
Usp3	A	G	9: 66,520,677	Y339H	probably damaging	Het
Vmn1r5	A	T	6: 56,986,251	K304*	probably null	Het
Vmn2r92	A	G	17: 18,166,857	T153A	probably benign	Het
Xkr5	A	T	8: 18,948,730	*55K	probably null	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
R9024:Chfr	UTSW	5	110158832	missense	probably benign	0.26
R9419:Chfr	UTSW	5	110169190	missense	probably damaging	1.00
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCAGAATAGTAATGCTGGGC -3'
(R):5'- CTTTAGAAAGGCCCAGCTGAAG -3'

Sequencing Primer
(F):5'- CAGAATAGTAATGCTGGGCAAATTTC -3'
(R):5'- CCACGACTGTCACTTTGTATGGAG -3'

Posted On

2015-11-11