Incidental Mutation 'R4742:Vmn1r5'
ID358125
Institutional Source Beutler Lab
Gene Symbol Vmn1r5
Ensembl Gene ENSMUSG00000090346
Gene Namevomeronasal 1 receptor 5
SynonymsV1rc19
MMRRC Submission 041966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4742 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location56970273-56988390 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 56986251 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 304 (K304*)
Ref Sequence ENSEMBL: ENSMUSP00000154081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164307] [ENSMUST00000226130] [ENSMUST00000228276]
Predicted Effect probably null
Transcript: ENSMUST00000164307
AA Change: K304*
SMART Domains Protein: ENSMUSP00000131092
Gene: ENSMUSG00000090346
AA Change: K304*

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226130
AA Change: K304*
Predicted Effect probably null
Transcript: ENSMUST00000228276
AA Change: K304*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
8030423J24Rik G T 13: 70,883,525 R17L unknown Het
Acan T C 7: 79,100,769 F1763L probably benign Het
Adgrb1 T A 15: 74,529,479 L108* probably null Het
Anapc2 T A 2: 25,273,543 probably null Het
Apbb1ip A G 2: 22,826,916 K177E unknown Het
Azgp1 T A 5: 137,989,626 Y223* probably null Het
BC005561 A T 5: 104,518,857 N415I probably benign Het
Cfap44 T G 16: 44,449,252 probably null Het
Chfr C T 5: 110,143,598 T94I probably benign Het
Chrna10 T G 7: 102,113,137 Q282P probably damaging Het
Col9a3 G T 2: 180,603,387 G130W unknown Het
Dcaf1 A G 9: 106,858,555 T901A probably benign Het
Dock2 T G 11: 34,294,170 probably null Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam160a2 A G 7: 105,384,311 V566A probably damaging Het
Fdxacb1 A G 9: 50,768,668 probably benign Het
Il31ra G T 13: 112,523,967 S615* probably null Het
Itgam C T 7: 128,113,073 S827F probably damaging Het
Mapkbp1 T A 2: 120,016,818 V512E probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nab2 T C 10: 127,662,827 T458A probably benign Het
Nadsyn1 A G 7: 143,798,630 probably benign Het
Nek10 A G 14: 14,861,624 D560G probably null Het
Olfr319 A G 11: 58,701,859 R53G probably benign Het
Olfr695 A T 7: 106,873,428 N272K probably damaging Het
Olfr910 T C 9: 38,539,656 S254P probably damaging Het
Park2 T A 17: 11,237,704 probably null Het
Pou1f1 C A 16: 65,523,481 P19T probably benign Het
Prdm9 A T 17: 15,553,521 D329E probably damaging Het
Ptprm A C 17: 66,744,751 Y962* probably null Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rtkn2 A G 10: 68,003,314 T154A possibly damaging Het
Slitrk3 T C 3: 73,048,565 D958G probably benign Het
Spata31d1b C A 13: 59,716,612 H525N probably damaging Het
Tacc2 A G 7: 130,625,967 R1461G probably benign Het
Tas2r105 G A 6: 131,686,851 H205Y probably damaging Het
Tenm4 A G 7: 96,797,484 N809D probably damaging Het
Tns1 A G 1: 74,124,290 probably null Het
Top1 A G 2: 160,703,570 probably null Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Txndc9 T C 1: 37,987,684 D135G possibly damaging Het
Usp3 A G 9: 66,520,677 Y339H probably damaging Het
Vmn2r92 A G 17: 18,166,857 T153A probably benign Het
Xkr5 A T 8: 18,948,730 *55K probably null Het
Other mutations in Vmn1r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Vmn1r5 APN 6 56985926 missense probably damaging 0.98
IGL02027:Vmn1r5 APN 6 56985655 missense probably damaging 0.97
IGL03133:Vmn1r5 APN 6 56985615 missense probably benign 0.10
IGL03412:Vmn1r5 APN 6 56985933 missense possibly damaging 0.90
R0316:Vmn1r5 UTSW 6 56985799 missense probably benign 0.27
R0378:Vmn1r5 UTSW 6 56985585 missense probably benign 0.00
R0946:Vmn1r5 UTSW 6 56986165 missense possibly damaging 0.64
R1511:Vmn1r5 UTSW 6 56985786 missense probably benign 0.02
R1553:Vmn1r5 UTSW 6 56985498 missense probably benign 0.00
R1823:Vmn1r5 UTSW 6 56985595 missense probably damaging 0.98
R3980:Vmn1r5 UTSW 6 56985651 missense probably damaging 1.00
R4473:Vmn1r5 UTSW 6 56985648 missense probably benign 0.01
R5321:Vmn1r5 UTSW 6 56985607 missense probably damaging 1.00
R5364:Vmn1r5 UTSW 6 56985598 missense probably damaging 0.98
R6102:Vmn1r5 UTSW 6 56986114 missense probably damaging 0.96
R6581:Vmn1r5 UTSW 6 56985381 missense probably benign
R6885:Vmn1r5 UTSW 6 56986057 missense possibly damaging 0.89
R7297:Vmn1r5 UTSW 6 56986219 missense possibly damaging 0.94
R8063:Vmn1r5 UTSW 6 56985598 missense probably damaging 0.98
R8766:Vmn1r5 UTSW 6 56986115 missense possibly damaging 0.76
Z1176:Vmn1r5 UTSW 6 56985948 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGACCATCTTGCTGCTGGTG -3'
(R):5'- AGGACTCTCTACTGTTTGACAAC -3'

Sequencing Primer
(F):5'- GGTCATGTATTGGGTAGACTTAATC -3'
(R):5'- ACTGTTGCTACACAGGACGATTC -3'
Posted On2015-11-11