Incidental Mutation 'R4742:Tas2r105'
ID358127
Institutional Source Beutler Lab
Gene Symbol Tas2r105
Ensembl Gene ENSMUSG00000051153
Gene Nametaste receptor, type 2, member 105
SynonymsT2r5, Tas2r5, T2R05, T2R9, mGR05, mt2r5
MMRRC Submission 041966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R4742 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131686532-131687495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131686851 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 205 (H205Y)
Ref Sequence ENSEMBL: ENSMUSP00000058006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
Predicted Effect probably damaging
Transcript: ENSMUST00000053652
AA Change: H205Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153
AA Change: H205Y

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Meta Mutation Damage Score 0.6644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation respond normally to a variety of bitter, sweet, umami, salty and sour stimuli but show a striking and selective impairement in their ability to taste cycloheximide (a bitter tastant). In addition, homozygotes are no longer behaviorally averse to cycloheximide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
8030423J24Rik G T 13: 70,883,525 R17L unknown Het
Acan T C 7: 79,100,769 F1763L probably benign Het
Adgrb1 T A 15: 74,529,479 L108* probably null Het
Anapc2 T A 2: 25,273,543 probably null Het
Apbb1ip A G 2: 22,826,916 K177E unknown Het
Azgp1 T A 5: 137,989,626 Y223* probably null Het
BC005561 A T 5: 104,518,857 N415I probably benign Het
Cfap44 T G 16: 44,449,252 probably null Het
Chfr C T 5: 110,143,598 T94I probably benign Het
Chrna10 T G 7: 102,113,137 Q282P probably damaging Het
Col9a3 G T 2: 180,603,387 G130W unknown Het
Dcaf1 A G 9: 106,858,555 T901A probably benign Het
Dock2 T G 11: 34,294,170 probably null Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam160a2 A G 7: 105,384,311 V566A probably damaging Het
Fdxacb1 A G 9: 50,768,668 probably benign Het
Il31ra G T 13: 112,523,967 S615* probably null Het
Itgam C T 7: 128,113,073 S827F probably damaging Het
Mapkbp1 T A 2: 120,016,818 V512E probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nab2 T C 10: 127,662,827 T458A probably benign Het
Nadsyn1 A G 7: 143,798,630 probably benign Het
Nek10 A G 14: 14,861,624 D560G probably null Het
Olfr319 A G 11: 58,701,859 R53G probably benign Het
Olfr695 A T 7: 106,873,428 N272K probably damaging Het
Olfr910 T C 9: 38,539,656 S254P probably damaging Het
Park2 T A 17: 11,237,704 probably null Het
Pou1f1 C A 16: 65,523,481 P19T probably benign Het
Prdm9 A T 17: 15,553,521 D329E probably damaging Het
Ptprm A C 17: 66,744,751 Y962* probably null Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rtkn2 A G 10: 68,003,314 T154A possibly damaging Het
Slitrk3 T C 3: 73,048,565 D958G probably benign Het
Spata31d1b C A 13: 59,716,612 H525N probably damaging Het
Tacc2 A G 7: 130,625,967 R1461G probably benign Het
Tenm4 A G 7: 96,797,484 N809D probably damaging Het
Tns1 A G 1: 74,124,290 probably null Het
Top1 A G 2: 160,703,570 probably null Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Txndc9 T C 1: 37,987,684 D135G possibly damaging Het
Usp3 A G 9: 66,520,677 Y339H probably damaging Het
Vmn1r5 A T 6: 56,986,251 K304* probably null Het
Vmn2r92 A G 17: 18,166,857 T153A probably benign Het
Xkr5 A T 8: 18,948,730 *55K probably null Het
Other mutations in Tas2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Tas2r105 APN 6 131687111 missense probably benign 0.02
IGL01148:Tas2r105 APN 6 131686852 missense probably damaging 1.00
IGL02882:Tas2r105 APN 6 131687180 missense possibly damaging 0.95
R0833:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R0836:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R1429:Tas2r105 UTSW 6 131686941 missense probably benign 0.01
R2010:Tas2r105 UTSW 6 131687402 missense probably benign 0.41
R2418:Tas2r105 UTSW 6 131687447 missense probably damaging 1.00
R4023:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R4026:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R5497:Tas2r105 UTSW 6 131686842 splice site probably null
R5812:Tas2r105 UTSW 6 131686873 missense possibly damaging 0.95
R7191:Tas2r105 UTSW 6 131686982 missense probably damaging 0.99
R7236:Tas2r105 UTSW 6 131686760 missense probably damaging 1.00
R7482:Tas2r105 UTSW 6 131687009 missense probably benign 0.10
R8783:Tas2r105 UTSW 6 131686769 missense possibly damaging 0.92
X0067:Tas2r105 UTSW 6 131687270 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAAGGCTTGCTTTAGCTGGC -3'
(R):5'- TTGCTAACTTCATGGGTAATCTCC -3'

Sequencing Primer
(F):5'- ATATGGATGCAGTTGTGAAACC -3'
(R):5'- ATGGGTAATCTCCTTCTCATTTGTTG -3'
Posted On2015-11-11