Incidental Mutation 'R4742:Acan'
ID358128
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission 041966-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4742 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79100769 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1763 (F1763L)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably benign
Transcript: ENSMUST00000032835
AA Change: F1763L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: F1763L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206779
AA Change: F340L
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
8030423J24Rik G T 13: 70,883,525 R17L unknown Het
Adgrb1 T A 15: 74,529,479 L108* probably null Het
Anapc2 T A 2: 25,273,543 probably null Het
Apbb1ip A G 2: 22,826,916 K177E unknown Het
Azgp1 T A 5: 137,989,626 Y223* probably null Het
BC005561 A T 5: 104,518,857 N415I probably benign Het
Cfap44 T G 16: 44,449,252 probably null Het
Chfr C T 5: 110,143,598 T94I probably benign Het
Chrna10 T G 7: 102,113,137 Q282P probably damaging Het
Col9a3 G T 2: 180,603,387 G130W unknown Het
Dcaf1 A G 9: 106,858,555 T901A probably benign Het
Dock2 T G 11: 34,294,170 probably null Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam160a2 A G 7: 105,384,311 V566A probably damaging Het
Fdxacb1 A G 9: 50,768,668 probably benign Het
Il31ra G T 13: 112,523,967 S615* probably null Het
Itgam C T 7: 128,113,073 S827F probably damaging Het
Mapkbp1 T A 2: 120,016,818 V512E probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nab2 T C 10: 127,662,827 T458A probably benign Het
Nadsyn1 A G 7: 143,798,630 probably benign Het
Nek10 A G 14: 14,861,624 D560G probably null Het
Olfr319 A G 11: 58,701,859 R53G probably benign Het
Olfr695 A T 7: 106,873,428 N272K probably damaging Het
Olfr910 T C 9: 38,539,656 S254P probably damaging Het
Park2 T A 17: 11,237,704 probably null Het
Pou1f1 C A 16: 65,523,481 P19T probably benign Het
Prdm9 A T 17: 15,553,521 D329E probably damaging Het
Ptprm A C 17: 66,744,751 Y962* probably null Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rtkn2 A G 10: 68,003,314 T154A possibly damaging Het
Slitrk3 T C 3: 73,048,565 D958G probably benign Het
Spata31d1b C A 13: 59,716,612 H525N probably damaging Het
Tacc2 A G 7: 130,625,967 R1461G probably benign Het
Tas2r105 G A 6: 131,686,851 H205Y probably damaging Het
Tenm4 A G 7: 96,797,484 N809D probably damaging Het
Tns1 A G 1: 74,124,290 probably null Het
Top1 A G 2: 160,703,570 probably null Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Txndc9 T C 1: 37,987,684 D135G possibly damaging Het
Usp3 A G 9: 66,520,677 Y339H probably damaging Het
Vmn1r5 A T 6: 56,986,251 K304* probably null Het
Vmn2r92 A G 17: 18,166,857 T153A probably benign Het
Xkr5 A T 8: 18,948,730 *55K probably null Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCAGGAACTTGGCCATG -3'
(R):5'- CCTGAAGTGCCTGTGTCTATGTC -3'

Sequencing Primer
(F):5'- AGGAACTTGGCCATGGTCCTTC -3'
(R):5'- CGGAGGTAGTGCTAGATTCTCCAC -3'
Posted On2015-11-11