Incidental Mutation 'R4742:Chrna10'
ID358130
Institutional Source Beutler Lab
Gene Symbol Chrna10
Ensembl Gene ENSMUSG00000066279
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 10
Synonyms
MMRRC Submission 041966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4742 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102111266-102116828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102113137 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 282 (Q282P)
Ref Sequence ENSEMBL: ENSMUSP00000081891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033300] [ENSMUST00000084830] [ENSMUST00000209809] [ENSMUST00000210211] [ENSMUST00000211408]
Predicted Effect probably benign
Transcript: ENSMUST00000033300
SMART Domains Protein: ENSMUSP00000033300
Gene: ENSMUSG00000030996

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ART 39 269 2e-99 PFAM
low complexity region 288 313 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084830
AA Change: Q282P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081891
Gene: ENSMUSG00000066279
AA Change: Q282P

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 30 236 1.5e-67 PFAM
Pfam:Neur_chan_memb 243 384 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209809
Predicted Effect probably benign
Transcript: ENSMUST00000210211
Predicted Effect probably benign
Transcript: ENSMUST00000211408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Meta Mutation Damage Score 0.5466 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired synaptic function and integrity of the olivocochlear system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
8030423J24Rik G T 13: 70,883,525 R17L unknown Het
Acan T C 7: 79,100,769 F1763L probably benign Het
Adgrb1 T A 15: 74,529,479 L108* probably null Het
Anapc2 T A 2: 25,273,543 probably null Het
Apbb1ip A G 2: 22,826,916 K177E unknown Het
Azgp1 T A 5: 137,989,626 Y223* probably null Het
BC005561 A T 5: 104,518,857 N415I probably benign Het
Cfap44 T G 16: 44,449,252 probably null Het
Chfr C T 5: 110,143,598 T94I probably benign Het
Col9a3 G T 2: 180,603,387 G130W unknown Het
Dcaf1 A G 9: 106,858,555 T901A probably benign Het
Dock2 T G 11: 34,294,170 probably null Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam160a2 A G 7: 105,384,311 V566A probably damaging Het
Fdxacb1 A G 9: 50,768,668 probably benign Het
Il31ra G T 13: 112,523,967 S615* probably null Het
Itgam C T 7: 128,113,073 S827F probably damaging Het
Mapkbp1 T A 2: 120,016,818 V512E probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nab2 T C 10: 127,662,827 T458A probably benign Het
Nadsyn1 A G 7: 143,798,630 probably benign Het
Nek10 A G 14: 14,861,624 D560G probably null Het
Olfr319 A G 11: 58,701,859 R53G probably benign Het
Olfr695 A T 7: 106,873,428 N272K probably damaging Het
Olfr910 T C 9: 38,539,656 S254P probably damaging Het
Park2 T A 17: 11,237,704 probably null Het
Pou1f1 C A 16: 65,523,481 P19T probably benign Het
Prdm9 A T 17: 15,553,521 D329E probably damaging Het
Ptprm A C 17: 66,744,751 Y962* probably null Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rtkn2 A G 10: 68,003,314 T154A possibly damaging Het
Slitrk3 T C 3: 73,048,565 D958G probably benign Het
Spata31d1b C A 13: 59,716,612 H525N probably damaging Het
Tacc2 A G 7: 130,625,967 R1461G probably benign Het
Tas2r105 G A 6: 131,686,851 H205Y probably damaging Het
Tenm4 A G 7: 96,797,484 N809D probably damaging Het
Tns1 A G 1: 74,124,290 probably null Het
Top1 A G 2: 160,703,570 probably null Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Txndc9 T C 1: 37,987,684 D135G possibly damaging Het
Usp3 A G 9: 66,520,677 Y339H probably damaging Het
Vmn1r5 A T 6: 56,986,251 K304* probably null Het
Vmn2r92 A G 17: 18,166,857 T153A probably benign Het
Xkr5 A T 8: 18,948,730 *55K probably null Het
Other mutations in Chrna10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Chrna10 APN 7 102112408 nonsense probably null
IGL02313:Chrna10 APN 7 102112029 unclassified probably benign
IGL02814:Chrna10 APN 7 102112262 missense probably benign 0.00
R0012:Chrna10 UTSW 7 102115057 missense possibly damaging 0.71
R0012:Chrna10 UTSW 7 102115057 missense possibly damaging 0.71
R1464:Chrna10 UTSW 7 102114247 missense probably damaging 1.00
R1464:Chrna10 UTSW 7 102114247 missense probably damaging 1.00
R2567:Chrna10 UTSW 7 102112069 missense probably benign 0.16
R3774:Chrna10 UTSW 7 102114328 missense probably benign 0.00
R4707:Chrna10 UTSW 7 102113219 missense possibly damaging 0.83
R4784:Chrna10 UTSW 7 102113219 missense possibly damaging 0.83
R4785:Chrna10 UTSW 7 102113219 missense possibly damaging 0.83
R5384:Chrna10 UTSW 7 102114353 missense probably damaging 0.97
R6355:Chrna10 UTSW 7 102113085 critical splice donor site probably null
R7215:Chrna10 UTSW 7 102112208 missense possibly damaging 0.95
R7253:Chrna10 UTSW 7 102112086 missense probably benign 0.00
R8368:Chrna10 UTSW 7 102115016 missense probably benign
Z1177:Chrna10 UTSW 7 102113264 missense probably benign 0.13
Z1177:Chrna10 UTSW 7 102114987 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATGCCTGGCACACAGCTATC -3'
(R):5'- CAGACGTGACCTTCACTCTG -3'

Sequencing Primer
(F):5'- TGGCACACAGCTATCACTACAATTTG -3'
(R):5'- GTGACCTTCACTCTGCTGCTG -3'
Posted On2015-11-11