Incidental Mutation 'R4742:Olfr910'
ID358138
Institutional Source Beutler Lab
Gene Symbol Olfr910
Ensembl Gene ENSMUSG00000060114
Gene Nameolfactory receptor 910
SynonymsMOR165-3, GA_x6K02T2PVTD-32239063-32239995
MMRRC Submission 041966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4742 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38537849-38540820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38539656 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 254 (S254P)
Ref Sequence ENSEMBL: ENSMUSP00000149263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215122]
Predicted Effect probably damaging
Transcript: ENSMUST00000073214
AA Change: S254P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072947
Gene: ENSMUSG00000057444
AA Change: S254P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-49 PFAM
Pfam:7tm_1 41 290 4.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215122
AA Change: S254P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
8030423J24Rik G T 13: 70,883,525 R17L unknown Het
Acan T C 7: 79,100,769 F1763L probably benign Het
Adgrb1 T A 15: 74,529,479 L108* probably null Het
Anapc2 T A 2: 25,273,543 probably null Het
Apbb1ip A G 2: 22,826,916 K177E unknown Het
Azgp1 T A 5: 137,989,626 Y223* probably null Het
BC005561 A T 5: 104,518,857 N415I probably benign Het
Cfap44 T G 16: 44,449,252 probably null Het
Chfr C T 5: 110,143,598 T94I probably benign Het
Chrna10 T G 7: 102,113,137 Q282P probably damaging Het
Col9a3 G T 2: 180,603,387 G130W unknown Het
Dcaf1 A G 9: 106,858,555 T901A probably benign Het
Dock2 T G 11: 34,294,170 probably null Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam160a2 A G 7: 105,384,311 V566A probably damaging Het
Fdxacb1 A G 9: 50,768,668 probably benign Het
Il31ra G T 13: 112,523,967 S615* probably null Het
Itgam C T 7: 128,113,073 S827F probably damaging Het
Mapkbp1 T A 2: 120,016,818 V512E probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nab2 T C 10: 127,662,827 T458A probably benign Het
Nadsyn1 A G 7: 143,798,630 probably benign Het
Nek10 A G 14: 14,861,624 D560G probably null Het
Olfr319 A G 11: 58,701,859 R53G probably benign Het
Olfr695 A T 7: 106,873,428 N272K probably damaging Het
Park2 T A 17: 11,237,704 probably null Het
Pou1f1 C A 16: 65,523,481 P19T probably benign Het
Prdm9 A T 17: 15,553,521 D329E probably damaging Het
Ptprm A C 17: 66,744,751 Y962* probably null Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rtkn2 A G 10: 68,003,314 T154A possibly damaging Het
Slitrk3 T C 3: 73,048,565 D958G probably benign Het
Spata31d1b C A 13: 59,716,612 H525N probably damaging Het
Tacc2 A G 7: 130,625,967 R1461G probably benign Het
Tas2r105 G A 6: 131,686,851 H205Y probably damaging Het
Tenm4 A G 7: 96,797,484 N809D probably damaging Het
Tns1 A G 1: 74,124,290 probably null Het
Top1 A G 2: 160,703,570 probably null Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Txndc9 T C 1: 37,987,684 D135G possibly damaging Het
Usp3 A G 9: 66,520,677 Y339H probably damaging Het
Vmn1r5 A T 6: 56,986,251 K304* probably null Het
Vmn2r92 A G 17: 18,166,857 T153A probably benign Het
Xkr5 A T 8: 18,948,730 *55K probably null Het
Other mutations in Olfr910
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02740:Olfr910 APN 9 38538930 missense probably damaging 1.00
R0096:Olfr910 UTSW 9 38539536 missense probably damaging 0.96
R0550:Olfr910 UTSW 9 38539380 missense probably damaging 0.97
R1375:Olfr910 UTSW 9 38539534 missense possibly damaging 0.63
R1698:Olfr910 UTSW 9 38539256 nonsense probably null
R2067:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2111:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2519:Olfr910 UTSW 9 38538985 missense probably damaging 0.99
R4782:Olfr910 UTSW 9 38539075 missense probably damaging 1.00
R6491:Olfr910 UTSW 9 38647455 missense probably damaging 1.00
R7101:Olfr910 UTSW 9 38539670 missense probably benign 0.02
R8108:Olfr910 UTSW 9 38539410 missense probably damaging 0.97
R8270:Olfr910 UTSW 9 38539348 missense noncoding transcript
Z1088:Olfr910 UTSW 9 38539149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACACCATCAATCACTACTTCTG -3'
(R):5'- AGTGAAGTAGGCACTGAACC -3'

Sequencing Primer
(F):5'- CAGCTTTCCTGCACAAGC -3'
(R):5'- AGGCACTGAACCAAGAAAATCTTG -3'
Posted On2015-11-11