Incidental Mutation 'R4742:Dcaf1'
ID358141
Institutional Source Beutler Lab
Gene Symbol Dcaf1
Ensembl Gene ENSMUSG00000040325
Gene NameDDB1 and CUL4 associated factor 1
SynonymsB930007L02Rik, Vprbp
MMRRC Submission 041966-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4742 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106821874-106880992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106858555 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 901 (T901A)
Ref Sequence ENSEMBL: ENSMUSP00000125730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000159645] [ENSMUST00000161758]
Predicted Effect probably benign
Transcript: ENSMUST00000055009
AA Change: T901A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325
AA Change: T901A

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1392 N/A PDB
SCOP:d1tbga_ 1063 1375 9e-20 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1393 1452 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
PDB:4P7I|D 1484 1506 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159645
AA Change: T901A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325
AA Change: T901A

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1394 N/A PDB
SCOP:d1tbga_ 1063 1375 1e-19 SMART
Blast:WD40 1078 1120 2e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1395 1402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161758
AA Change: T901A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325
AA Change: T901A

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1398 N/A PDB
SCOP:d1tbga_ 1063 1308 3e-19 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1399 1458 N/A INTRINSIC
low complexity region 1463 1489 N/A INTRINSIC
PDB:4P7I|D 1490 1512 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188343
Meta Mutation Damage Score 0.0859 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
8030423J24Rik G T 13: 70,883,525 R17L unknown Het
Acan T C 7: 79,100,769 F1763L probably benign Het
Adgrb1 T A 15: 74,529,479 L108* probably null Het
Anapc2 T A 2: 25,273,543 probably null Het
Apbb1ip A G 2: 22,826,916 K177E unknown Het
Azgp1 T A 5: 137,989,626 Y223* probably null Het
BC005561 A T 5: 104,518,857 N415I probably benign Het
Cfap44 T G 16: 44,449,252 probably null Het
Chfr C T 5: 110,143,598 T94I probably benign Het
Chrna10 T G 7: 102,113,137 Q282P probably damaging Het
Col9a3 G T 2: 180,603,387 G130W unknown Het
Dock2 T G 11: 34,294,170 probably null Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam160a2 A G 7: 105,384,311 V566A probably damaging Het
Fdxacb1 A G 9: 50,768,668 probably benign Het
Il31ra G T 13: 112,523,967 S615* probably null Het
Itgam C T 7: 128,113,073 S827F probably damaging Het
Mapkbp1 T A 2: 120,016,818 V512E probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nab2 T C 10: 127,662,827 T458A probably benign Het
Nadsyn1 A G 7: 143,798,630 probably benign Het
Nek10 A G 14: 14,861,624 D560G probably null Het
Olfr319 A G 11: 58,701,859 R53G probably benign Het
Olfr695 A T 7: 106,873,428 N272K probably damaging Het
Olfr910 T C 9: 38,539,656 S254P probably damaging Het
Park2 T A 17: 11,237,704 probably null Het
Pou1f1 C A 16: 65,523,481 P19T probably benign Het
Prdm9 A T 17: 15,553,521 D329E probably damaging Het
Ptprm A C 17: 66,744,751 Y962* probably null Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rtkn2 A G 10: 68,003,314 T154A possibly damaging Het
Slitrk3 T C 3: 73,048,565 D958G probably benign Het
Spata31d1b C A 13: 59,716,612 H525N probably damaging Het
Tacc2 A G 7: 130,625,967 R1461G probably benign Het
Tas2r105 G A 6: 131,686,851 H205Y probably damaging Het
Tenm4 A G 7: 96,797,484 N809D probably damaging Het
Tns1 A G 1: 74,124,290 probably null Het
Top1 A G 2: 160,703,570 probably null Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Txndc9 T C 1: 37,987,684 D135G possibly damaging Het
Usp3 A G 9: 66,520,677 Y339H probably damaging Het
Vmn1r5 A T 6: 56,986,251 K304* probably null Het
Vmn2r92 A G 17: 18,166,857 T153A probably benign Het
Xkr5 A T 8: 18,948,730 *55K probably null Het
Other mutations in Dcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Dcaf1 APN 9 106858333 missense probably benign 0.45
IGL01314:Dcaf1 APN 9 106834191 missense probably benign 0.07
IGL01395:Dcaf1 APN 9 106858162 missense possibly damaging 0.73
IGL01936:Dcaf1 APN 9 106859601 missense possibly damaging 0.81
IGL02089:Dcaf1 APN 9 106863111 missense probably benign 0.40
IGL02596:Dcaf1 APN 9 106863021 missense probably damaging 1.00
IGL02828:Dcaf1 APN 9 106844302 splice site probably benign
IGL03036:Dcaf1 APN 9 106844140 missense probably damaging 1.00
IGL03327:Dcaf1 APN 9 106858624 missense possibly damaging 0.79
Latte UTSW 9 106846772 nonsense probably null
IGL02799:Dcaf1 UTSW 9 106857940 missense probably benign 0.42
P0023:Dcaf1 UTSW 9 106860451 missense probably benign 0.40
R0087:Dcaf1 UTSW 9 106863089 missense probably damaging 1.00
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0562:Dcaf1 UTSW 9 106844122 splice site probably benign
R0690:Dcaf1 UTSW 9 106846649 splice site probably benign
R1373:Dcaf1 UTSW 9 106857880 missense probably benign 0.18
R1508:Dcaf1 UTSW 9 106854177 missense probably damaging 1.00
R1765:Dcaf1 UTSW 9 106864594 missense probably damaging 1.00
R1845:Dcaf1 UTSW 9 106851962 missense probably benign 0.01
R2016:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106847923 missense probably damaging 0.99
R2246:Dcaf1 UTSW 9 106854177 missense possibly damaging 0.94
R2321:Dcaf1 UTSW 9 106838473 missense probably benign 0.04
R4528:Dcaf1 UTSW 9 106844204 missense probably damaging 1.00
R4646:Dcaf1 UTSW 9 106846807 missense probably benign 0.27
R4648:Dcaf1 UTSW 9 106865677 unclassified probably benign
R5876:Dcaf1 UTSW 9 106863650 missense probably damaging 1.00
R5926:Dcaf1 UTSW 9 106838362 missense probably benign 0.02
R6057:Dcaf1 UTSW 9 106854247 missense probably damaging 0.99
R6335:Dcaf1 UTSW 9 106838646 missense possibly damaging 0.63
R6518:Dcaf1 UTSW 9 106835589 missense probably damaging 1.00
R6812:Dcaf1 UTSW 9 106858069 missense probably damaging 1.00
R6829:Dcaf1 UTSW 9 106838604 missense probably damaging 0.97
R6972:Dcaf1 UTSW 9 106846772 nonsense probably null
R7175:Dcaf1 UTSW 9 106858576 missense probably benign 0.32
R7650:Dcaf1 UTSW 9 106838344 missense probably benign 0.01
R7734:Dcaf1 UTSW 9 106838679 missense probably damaging 1.00
X0019:Dcaf1 UTSW 9 106834159 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCCTTCCCTGAGAAAGAGC -3'
(R):5'- CCGCAACACTCGAATTTTCC -3'

Sequencing Primer
(F):5'- GAAAGAGCTGCTCCTGTTGATAC -3'
(R):5'- GGTGATGGCCTCTCTCTGATAAAAC -3'
Posted On2015-11-11