Mutagenetix > Incidental Mutation

Incidental Mutation 'R4742:Adgrb1'

358150

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

B830018M07Rik, Bai1

MMRRC Submission

041966-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4742 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74388045-74461314 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 74401328 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 108 (L108*)

Ref Sequence

ENSEMBL: ENSMUSP00000140959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]

AlphaFold

Q3UHD1

Predicted Effect

probably null
Transcript: ENSMUST00000042035
AA Change: L108*

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: L108*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000186360
AA Change: L108*

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: L108*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000187485
AA Change: L108*

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730
AA Change: L108*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030423J24Rik	G	T	13: 71,031,644 (GRCm39)	R17L	unknown	Het
Acan	T	C	7: 78,750,517 (GRCm39)	F1763L	probably benign	Het
Anapc2	T	A	2: 25,163,555 (GRCm39)		probably null	Het
Apbb1ip	A	G	2: 22,716,928 (GRCm39)	K177E	unknown	Het
Azgp1	T	A	5: 137,987,888 (GRCm39)	Y223*	probably null	Het
Cfap44	T	G	16: 44,269,615 (GRCm39)		probably null	Het
Chfr	C	T	5: 110,291,464 (GRCm39)	T94I	probably benign	Het
Chrna10	T	G	7: 101,762,344 (GRCm39)	Q282P	probably damaging	Het
Col9a3	G	T	2: 180,245,180 (GRCm39)	G130W	unknown	Het
Dcaf1	A	G	9: 106,735,754 (GRCm39)	T901A	probably benign	Het
Dock2	T	G	11: 34,244,170 (GRCm39)		probably null	Het
Dysf	C	A	6: 84,074,697 (GRCm39)	D499E	probably damaging	Het
Fdxacb1	A	G	9: 50,679,968 (GRCm39)		probably benign	Het
Fhip1b	A	G	7: 105,033,518 (GRCm39)	V566A	probably damaging	Het
Il31ra	G	T	13: 112,660,501 (GRCm39)	S615*	probably null	Het
Itgam	C	T	7: 127,712,245 (GRCm39)	S827F	probably damaging	Het
Mapkbp1	T	A	2: 119,847,299 (GRCm39)	V512E	probably damaging	Het
Myo1c	C	T	11: 75,560,856 (GRCm39)	R770*	probably null	Het
Nab2	T	C	10: 127,498,696 (GRCm39)	T458A	probably benign	Het
Nadsyn1	A	G	7: 143,352,367 (GRCm39)		probably benign	Het
Nek10	A	G	14: 14,861,624 (GRCm38)	D560G	probably null	Het
Or2ag13	A	T	7: 106,472,635 (GRCm39)	N272K	probably damaging	Het
Or2ak6	A	G	11: 58,592,685 (GRCm39)	R53G	probably benign	Het
Or8b46	T	C	9: 38,450,952 (GRCm39)	S254P	probably damaging	Het
Pou1f1	C	A	16: 65,320,367 (GRCm39)	P19T	probably benign	Het
Prdm9	A	T	17: 15,773,783 (GRCm39)	D329E	probably damaging	Het
Prkn	T	A	17: 11,456,591 (GRCm39)		probably null	Het
Ptprm	A	C	17: 67,051,746 (GRCm39)	Y962*	probably null	Het
Rad9a	G	A	19: 4,250,560 (GRCm39)	R85C	probably damaging	Het
Rhox2c	A	C	X: 36,635,351 (GRCm39)	Q4H	probably benign	Het
Rlig1	T	C	10: 100,414,243 (GRCm39)	I139V	probably benign	Het
Rtkn2	A	G	10: 67,839,144 (GRCm39)	T154A	possibly damaging	Het
Slitrk3	T	C	3: 72,955,898 (GRCm39)	D958G	probably benign	Het
Spata31d1b	C	A	13: 59,864,426 (GRCm39)	H525N	probably damaging	Het
Tacc2	A	G	7: 130,227,697 (GRCm39)	R1461G	probably benign	Het
Tas2r105	G	A	6: 131,663,814 (GRCm39)	H205Y	probably damaging	Het
Tenm4	A	G	7: 96,446,691 (GRCm39)	N809D	probably damaging	Het
Thoc2l	A	T	5: 104,666,723 (GRCm39)	N415I	probably benign	Het
Tns1	A	G	1: 74,163,449 (GRCm39)		probably null	Het
Top1	A	G	2: 160,545,490 (GRCm39)		probably null	Het
Traf3ip2	C	T	10: 39,515,256 (GRCm39)	P345S	possibly damaging	Het
Ttn	T	A	2: 76,585,168 (GRCm39)	I22042F	probably damaging	Het
Txndc9	T	C	1: 38,026,765 (GRCm39)	D135G	possibly damaging	Het
Usp3	A	G	9: 66,427,959 (GRCm39)	Y339H	probably damaging	Het
Vmn1r5	A	T	6: 56,963,236 (GRCm39)	K304*	probably null	Het
Vmn2r92	A	G	17: 18,387,119 (GRCm39)	T153A	probably benign	Het
Xkr5	A	T	8: 18,998,746 (GRCm39)	*55K	probably null	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74,458,684 (GRCm39)	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74,420,206 (GRCm39)	splice site	probably benign
IGL01874:Adgrb1	APN	15	74,413,423 (GRCm39)	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74,413,424 (GRCm39)	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74,401,631 (GRCm39)	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74,412,326 (GRCm39)	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74,445,961 (GRCm39)	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74,458,654 (GRCm39)	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74,460,143 (GRCm39)	splice site	probably benign
IGL02678:Adgrb1	APN	15	74,410,177 (GRCm39)	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74,419,471 (GRCm39)	missense	probably damaging	0.98
Bunting	UTSW	15	74,415,550 (GRCm39)	missense	probably null	0.94
BB005:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
BB015:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74,413,508 (GRCm39)	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74,444,005 (GRCm39)	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74,458,656 (GRCm39)	missense	probably benign
R0267:Adgrb1	UTSW	15	74,401,238 (GRCm39)	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74,458,998 (GRCm39)	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74,415,198 (GRCm39)	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74,413,408 (GRCm39)	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74,412,741 (GRCm39)	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74,420,398 (GRCm39)	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74,452,466 (GRCm39)	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74,419,534 (GRCm39)	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74,421,888 (GRCm39)	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74,452,466 (GRCm39)	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74,459,956 (GRCm39)	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74,401,192 (GRCm39)	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74,413,676 (GRCm39)	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74,401,389 (GRCm39)	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74,452,435 (GRCm39)	nonsense	probably null
R1895:Adgrb1	UTSW	15	74,412,314 (GRCm39)	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74,411,726 (GRCm39)	splice site	probably benign
R2114:Adgrb1	UTSW	15	74,412,411 (GRCm39)	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74,401,757 (GRCm39)	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74,419,553 (GRCm39)	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74,416,864 (GRCm39)	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74,460,157 (GRCm39)	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74,454,792 (GRCm39)	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74,415,511 (GRCm39)	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74,449,302 (GRCm39)	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74,456,278 (GRCm39)	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74,459,963 (GRCm39)	missense	probably damaging	1.00
R4760:Adgrb1	UTSW	15	74,443,312 (GRCm39)	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74,459,978 (GRCm39)	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74,458,871 (GRCm39)	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74,444,011 (GRCm39)	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74,401,664 (GRCm39)	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74,415,550 (GRCm39)	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74,449,348 (GRCm39)	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74,421,876 (GRCm39)	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74,413,423 (GRCm39)	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74,410,219 (GRCm39)	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74,412,292 (GRCm39)	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74,412,292 (GRCm39)	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74,412,308 (GRCm39)	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74,459,992 (GRCm39)	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74,401,210 (GRCm39)	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74,421,873 (GRCm39)	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74,401,750 (GRCm39)	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74,445,959 (GRCm39)	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74,441,730 (GRCm39)	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74,441,797 (GRCm39)	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74,441,733 (GRCm39)	missense	probably benign
R7283:Adgrb1	UTSW	15	74,452,512 (GRCm39)	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74,411,094 (GRCm39)	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74,420,418 (GRCm39)	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74,415,487 (GRCm39)	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74,416,849 (GRCm39)	missense	probably damaging	0.98
R8152:Adgrb1	UTSW	15	74,413,460 (GRCm39)	missense	probably benign	0.00
R8198:Adgrb1	UTSW	15	74,411,094 (GRCm39)	missense	probably damaging	0.99
R8485:Adgrb1	UTSW	15	74,420,153 (GRCm39)	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74,447,700 (GRCm39)	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74,415,357 (GRCm39)	missense	probably damaging	0.97
R8865:Adgrb1	UTSW	15	74,415,507 (GRCm39)	missense	possibly damaging	0.75
R9044:Adgrb1	UTSW	15	74,441,748 (GRCm39)	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74,415,189 (GRCm39)	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74,411,624 (GRCm39)	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74,420,475 (GRCm39)	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74,411,624 (GRCm39)	missense	probably damaging	0.98
R9445:Adgrb1	UTSW	15	74,435,807 (GRCm39)	critical splice acceptor site	probably benign
Z1177:Adgrb1	UTSW	15	74,419,532 (GRCm39)	missense	probably damaging	0.99
Z1177:Adgrb1	UTSW	15	74,413,525 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAAGTTCTTCGGCTACTTCTCGG -3'
(R):5'- ACACAGCATCTGACAGGCAG -3'

Sequencing Primer
(F):5'- CGGCGGCTGCTGTATTTCC -3'
(R):5'- TCCACGGAGAAGTCGTCACTAG -3'

Posted On

2015-11-11