Incidental Mutation 'R4742:Vmn2r92'
ID358155
Institutional Source Beutler Lab
Gene Symbol Vmn2r92
Ensembl Gene ENSMUSG00000091350
Gene Namevomeronasal 2, receptor 92
SynonymsEG627111
MMRRC Submission 041966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4742 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18151887-18188886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18166857 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 153 (T153A)
Ref Sequence ENSEMBL: ENSMUSP00000128685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169686]
Predicted Effect probably benign
Transcript: ENSMUST00000169686
AA Change: T153A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128685
Gene: ENSMUSG00000091350
AA Change: T153A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 463 4.7e-38 PFAM
Pfam:NCD3G 510 564 2.5e-19 PFAM
Pfam:7tm_3 597 832 1.1e-52 PFAM
low complexity region 843 855 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
8030423J24Rik G T 13: 70,883,525 R17L unknown Het
Acan T C 7: 79,100,769 F1763L probably benign Het
Adgrb1 T A 15: 74,529,479 L108* probably null Het
Anapc2 T A 2: 25,273,543 probably null Het
Apbb1ip A G 2: 22,826,916 K177E unknown Het
Azgp1 T A 5: 137,989,626 Y223* probably null Het
BC005561 A T 5: 104,518,857 N415I probably benign Het
Cfap44 T G 16: 44,449,252 probably null Het
Chfr C T 5: 110,143,598 T94I probably benign Het
Chrna10 T G 7: 102,113,137 Q282P probably damaging Het
Col9a3 G T 2: 180,603,387 G130W unknown Het
Dcaf1 A G 9: 106,858,555 T901A probably benign Het
Dock2 T G 11: 34,294,170 probably null Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam160a2 A G 7: 105,384,311 V566A probably damaging Het
Fdxacb1 A G 9: 50,768,668 probably benign Het
Il31ra G T 13: 112,523,967 S615* probably null Het
Itgam C T 7: 128,113,073 S827F probably damaging Het
Mapkbp1 T A 2: 120,016,818 V512E probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nab2 T C 10: 127,662,827 T458A probably benign Het
Nadsyn1 A G 7: 143,798,630 probably benign Het
Nek10 A G 14: 14,861,624 D560G probably null Het
Olfr319 A G 11: 58,701,859 R53G probably benign Het
Olfr695 A T 7: 106,873,428 N272K probably damaging Het
Olfr910 T C 9: 38,539,656 S254P probably damaging Het
Park2 T A 17: 11,237,704 probably null Het
Pou1f1 C A 16: 65,523,481 P19T probably benign Het
Prdm9 A T 17: 15,553,521 D329E probably damaging Het
Ptprm A C 17: 66,744,751 Y962* probably null Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rtkn2 A G 10: 68,003,314 T154A possibly damaging Het
Slitrk3 T C 3: 73,048,565 D958G probably benign Het
Spata31d1b C A 13: 59,716,612 H525N probably damaging Het
Tacc2 A G 7: 130,625,967 R1461G probably benign Het
Tas2r105 G A 6: 131,686,851 H205Y probably damaging Het
Tenm4 A G 7: 96,797,484 N809D probably damaging Het
Tns1 A G 1: 74,124,290 probably null Het
Top1 A G 2: 160,703,570 probably null Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Txndc9 T C 1: 37,987,684 D135G possibly damaging Het
Usp3 A G 9: 66,520,677 Y339H probably damaging Het
Vmn1r5 A T 6: 56,986,251 K304* probably null Het
Xkr5 A T 8: 18,948,730 *55K probably null Het
Other mutations in Vmn2r92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Vmn2r92 APN 17 18185161 missense unknown
IGL01758:Vmn2r92 APN 17 18152013 nonsense probably null
IGL02614:Vmn2r92 APN 17 18167241 splice site probably benign
IGL03095:Vmn2r92 APN 17 18166710 missense possibly damaging 0.55
IGL03403:Vmn2r92 APN 17 18166852 missense probably damaging 0.98
R0133:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0225:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0227:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0265:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0266:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0267:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0420:Vmn2r92 UTSW 17 18168921 missense probably benign 0.01
R0426:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0494:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R1253:Vmn2r92 UTSW 17 18166766 missense probably benign 0.08
R1497:Vmn2r92 UTSW 17 18167363 missense probably benign 0.02
R1571:Vmn2r92 UTSW 17 18152090 missense probably damaging 0.96
R1656:Vmn2r92 UTSW 17 18151936 missense probably benign
R1816:Vmn2r92 UTSW 17 18166677 missense probably damaging 0.98
R2229:Vmn2r92 UTSW 17 18167392 missense probably benign 0.01
R2909:Vmn2r92 UTSW 17 18185115 missense possibly damaging 0.89
R3694:Vmn2r92 UTSW 17 18151943 nonsense probably null
R4207:Vmn2r92 UTSW 17 18184261 missense possibly damaging 0.62
R4548:Vmn2r92 UTSW 17 18171316 missense probably benign
R4612:Vmn2r92 UTSW 17 18166870 missense probably benign 0.25
R4824:Vmn2r92 UTSW 17 18151921 utr 5 prime probably benign
R4865:Vmn2r92 UTSW 17 18167372 missense probably benign 0.16
R4900:Vmn2r92 UTSW 17 18184343 missense probably benign 0.27
R5084:Vmn2r92 UTSW 17 18185177 makesense probably null
R5140:Vmn2r92 UTSW 17 18152050 missense probably benign 0.07
R5995:Vmn2r92 UTSW 17 18168951 critical splice donor site probably null
R6045:Vmn2r92 UTSW 17 18168043 critical splice donor site probably null
R6269:Vmn2r92 UTSW 17 18166774 missense probably benign 0.01
R6877:Vmn2r92 UTSW 17 18168822 missense probably damaging 1.00
R7151:Vmn2r92 UTSW 17 18166743 missense probably benign 0.01
R7260:Vmn2r92 UTSW 17 18166876 missense probably damaging 1.00
R7344:Vmn2r92 UTSW 17 18167251 missense probably benign 0.01
R7514:Vmn2r92 UTSW 17 18171271 missense probably damaging 1.00
R7576:Vmn2r92 UTSW 17 18167359 missense probably benign 0.01
R7584:Vmn2r92 UTSW 17 18166766 missense probably benign 0.08
R7912:Vmn2r92 UTSW 17 18184708 missense possibly damaging 0.91
R7941:Vmn2r92 UTSW 17 18184837 missense possibly damaging 0.89
R8178:Vmn2r92 UTSW 17 18166726 missense possibly damaging 0.69
R8238:Vmn2r92 UTSW 17 18185016 missense probably benign 0.00
R8239:Vmn2r92 UTSW 17 18185016 missense probably benign 0.00
R8252:Vmn2r92 UTSW 17 18166872 missense probably damaging 1.00
R8322:Vmn2r92 UTSW 17 18166624 missense probably damaging 0.99
X0066:Vmn2r92 UTSW 17 18184895 missense probably damaging 1.00
Z1177:Vmn2r92 UTSW 17 18184533 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGGAGATCAATGGGAACCCC -3'
(R):5'- TGGCTCATTGACTACACCAAC -3'

Sequencing Primer
(F):5'- GGAACCCCAATCTTTTACCCAATAC -3'
(R):5'- GGCTCATTGACTACACCAACCTTTC -3'
Posted On2015-11-11