Incidental Mutation 'R4743:Colgalt2'
ID 358162
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Name collagen beta(1-O)galactosyltransferase 2
Synonyms Glt25d2
MMRRC Submission 041967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R4743 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 152399830-152510695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152400343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 69 (Y69C)
Ref Sequence ENSEMBL: ENSMUSP00000119210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
AlphaFold Q6NVG7
Predicted Effect possibly damaging
Transcript: ENSMUST00000044311
AA Change: Y69C

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: Y69C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127586
AA Change: Y69C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649
AA Change: Y69C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4933407L21Rik A G 1: 85,931,251 probably benign Het
Ahcy T C 2: 155,068,968 N27D probably damaging Het
Akap9 T G 5: 3,961,013 L572R probably damaging Het
Akna A G 4: 63,378,613 S909P probably damaging Het
Atr A G 9: 95,862,792 E54G probably benign Het
Baz2b A G 2: 59,913,911 S1417P probably benign Het
Comp A G 8: 70,376,061 E181G probably damaging Het
Dcaf10 T A 4: 45,370,409 S326T probably damaging Het
Dscam T C 16: 96,830,056 E253G probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Epha1 G T 6: 42,372,221 T36K probably benign Het
Ewsr1 A T 11: 5,083,541 D210E unknown Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fndc1 T A 17: 7,772,279 R862* probably null Het
Gbp8 T C 5: 105,030,841 K203E possibly damaging Het
Gigyf2 T A 1: 87,365,248 L79* probably null Het
Gm8220 T A 14: 44,285,695 probably benign Het
Gm9755 A T 8: 67,514,277 noncoding transcript Het
Il6 T C 5: 30,018,044 Y120H probably damaging Het
Kcnma1 T C 14: 23,803,202 T2A probably damaging Het
Mroh9 T C 1: 163,024,492 Y876C probably benign Het
Plekhh2 A G 17: 84,571,120 Y601C probably damaging Het
Rabgap1l G T 1: 160,453,783 Q623K probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rapgef2 T C 3: 79,173,068 Y109C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Slain2 T A 5: 72,957,584 L386* probably null Het
Slc4a7 A G 14: 14,796,073 probably null Het
Slco1c1 T C 6: 141,564,516 C582R probably damaging Het
Sulf1 A G 1: 12,836,293 N520D probably benign Het
Tbc1d7 A G 13: 43,169,849 V22A probably damaging Het
Tmprss6 A G 15: 78,443,710 V612A probably damaging Het
Trpv2 A G 11: 62,592,801 E488G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uspl1 A G 5: 149,209,756 Y439C probably damaging Het
Vwf A G 6: 125,684,091 probably null Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152506878 missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152508730 missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152473108 missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152484871 missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152471813 splice site probably benign
R0605:Colgalt2 UTSW 1 152495792 splice site probably benign
R0628:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152503017 missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152504153 missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152484904 missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152484952 missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152400363 missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152468550 missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152508611 nonsense probably null
R3917:Colgalt2 UTSW 1 152508611 nonsense probably null
R4250:Colgalt2 UTSW 1 152489887 missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152468531 missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152485012 missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152506876 missense probably damaging 1.00
R4751:Colgalt2 UTSW 1 152489876 missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152484998 missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152499959 missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152484869 missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152400303 missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152504122 missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152471798 missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152506828 missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152504144 missense probably damaging 0.97
R8462:Colgalt2 UTSW 1 152503072 missense probably damaging 1.00
R8725:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R8727:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R9118:Colgalt2 UTSW 1 152503155 intron probably benign
R9186:Colgalt2 UTSW 1 152508652 missense probably damaging 0.98
R9393:Colgalt2 UTSW 1 152484847 nonsense probably null
R9611:Colgalt2 UTSW 1 152484994 missense probably damaging 1.00
X0028:Colgalt2 UTSW 1 152471720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAAATCAGTGCCGGTGC -3'
(R):5'- AGGTCTCCAGATTCTCGTCC -3'

Sequencing Primer
(F):5'- TACGGAACATGGCTGCG -3'
(R):5'- AGGTCTCCAGATTCTCGTCCATAGG -3'
Posted On 2015-11-11