Incidental Mutation 'R4743:Plekhh2'
ID358196
Institutional Source Beutler Lab
Gene Symbol Plekhh2
Ensembl Gene ENSMUSG00000040852
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Synonyms
MMRRC Submission 041967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4743 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84511895-84622142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84571120 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 601 (Y601C)
Ref Sequence ENSEMBL: ENSMUSP00000039628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047206]
Predicted Effect probably damaging
Transcript: ENSMUST00000047206
AA Change: Y601C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: Y601C

DomainStartEndE-ValueType
coiled coil region 19 84 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
coiled coil region 137 174 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
low complexity region 612 651 N/A INTRINSIC
low complexity region 657 666 N/A INTRINSIC
PH 703 798 4.7e-19 SMART
PH 811 920 1.15e-4 SMART
MyTH4 954 1109 8.49e-39 SMART
B41 1116 1353 1.01e-27 SMART
Meta Mutation Damage Score 0.2117 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4933407L21Rik A G 1: 85,931,251 probably benign Het
Ahcy T C 2: 155,068,968 N27D probably damaging Het
Akap9 T G 5: 3,961,013 L572R probably damaging Het
Akna A G 4: 63,378,613 S909P probably damaging Het
Atr A G 9: 95,862,792 E54G probably benign Het
Baz2b A G 2: 59,913,911 S1417P probably benign Het
Colgalt2 A G 1: 152,400,343 Y69C probably damaging Het
Comp A G 8: 70,376,061 E181G probably damaging Het
Dcaf10 T A 4: 45,370,409 S326T probably damaging Het
Dscam T C 16: 96,830,056 E253G probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Epha1 G T 6: 42,372,221 T36K probably benign Het
Ewsr1 A T 11: 5,083,541 D210E unknown Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fndc1 T A 17: 7,772,279 R862* probably null Het
Gbp8 T C 5: 105,030,841 K203E possibly damaging Het
Gigyf2 T A 1: 87,365,248 L79* probably null Het
Gm8220 T A 14: 44,285,695 probably benign Het
Gm9755 A T 8: 67,514,277 noncoding transcript Het
Il6 T C 5: 30,018,044 Y120H probably damaging Het
Kcnma1 T C 14: 23,803,202 T2A probably damaging Het
Mroh9 T C 1: 163,024,492 Y876C probably benign Het
Rabgap1l G T 1: 160,453,783 Q623K probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rapgef2 T C 3: 79,173,068 Y109C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Slain2 T A 5: 72,957,584 L386* probably null Het
Slc4a7 A G 14: 14,796,073 probably null Het
Slco1c1 T C 6: 141,564,516 C582R probably damaging Het
Sulf1 A G 1: 12,836,293 N520D probably benign Het
Tbc1d7 A G 13: 43,169,849 V22A probably damaging Het
Tmprss6 A G 15: 78,443,710 V612A probably damaging Het
Trpv2 A G 11: 62,592,801 E488G probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uspl1 A G 5: 149,209,756 Y439C probably damaging Het
Vwf A G 6: 125,684,091 probably null Het
Other mutations in Plekhh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Plekhh2 APN 17 84521775 missense probably benign 0.00
IGL00514:Plekhh2 APN 17 84596306 critical splice donor site probably null
IGL00773:Plekhh2 APN 17 84606868 missense probably benign 0.01
IGL00985:Plekhh2 APN 17 84563928 missense probably benign 0.00
IGL01116:Plekhh2 APN 17 84606928 missense possibly damaging 0.94
IGL01394:Plekhh2 APN 17 84557430 missense probably benign 0.24
IGL01419:Plekhh2 APN 17 84583552 splice site probably benign
IGL01932:Plekhh2 APN 17 84577261 missense probably benign 0.00
IGL02097:Plekhh2 APN 17 84599180 missense possibly damaging 0.69
IGL02157:Plekhh2 APN 17 84566942 splice site probably benign
IGL02163:Plekhh2 APN 17 84590795 missense probably benign 0.45
IGL02237:Plekhh2 APN 17 84575785 missense probably benign 0.00
IGL02322:Plekhh2 APN 17 84589466 nonsense probably null
IGL02422:Plekhh2 APN 17 84563809 splice site probably benign
IGL02483:Plekhh2 APN 17 84596260 missense possibly damaging 0.81
IGL02493:Plekhh2 APN 17 84606963 critical splice donor site probably null
IGL03007:Plekhh2 APN 17 84574960 missense possibly damaging 0.65
R0003:Plekhh2 UTSW 17 84557392 missense probably damaging 1.00
R0005:Plekhh2 UTSW 17 84586433 missense probably benign 0.16
R0099:Plekhh2 UTSW 17 84591672 nonsense probably null
R0331:Plekhh2 UTSW 17 84586366 missense possibly damaging 0.81
R0883:Plekhh2 UTSW 17 84618031 missense probably benign 0.11
R1051:Plekhh2 UTSW 17 84521827 critical splice donor site probably null
R1084:Plekhh2 UTSW 17 84571126 missense probably damaging 0.99
R1351:Plekhh2 UTSW 17 84577146 splice site probably benign
R1459:Plekhh2 UTSW 17 84610775 nonsense probably null
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1510:Plekhh2 UTSW 17 84559576 splice site probably null
R1699:Plekhh2 UTSW 17 84577184 nonsense probably null
R1738:Plekhh2 UTSW 17 84566697 missense possibly damaging 0.67
R1773:Plekhh2 UTSW 17 84599265 missense probably damaging 1.00
R1796:Plekhh2 UTSW 17 84599133 critical splice acceptor site probably null
R1823:Plekhh2 UTSW 17 84575189 missense probably damaging 1.00
R1998:Plekhh2 UTSW 17 84606877 missense possibly damaging 0.58
R2437:Plekhh2 UTSW 17 84586479 splice site probably null
R2847:Plekhh2 UTSW 17 84597966 missense probably damaging 1.00
R4088:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R4227:Plekhh2 UTSW 17 84566795 missense probably benign 0.00
R4249:Plekhh2 UTSW 17 84586337 missense possibly damaging 0.93
R4347:Plekhh2 UTSW 17 84619702 missense probably benign 0.12
R4562:Plekhh2 UTSW 17 84566097 missense probably benign 0.00
R4649:Plekhh2 UTSW 17 84575263 missense probably damaging 1.00
R4737:Plekhh2 UTSW 17 84563959 missense probably benign
R4858:Plekhh2 UTSW 17 84600697 missense probably damaging 1.00
R5036:Plekhh2 UTSW 17 84571761 missense probably damaging 0.99
R5260:Plekhh2 UTSW 17 84577165 missense probably damaging 0.99
R5385:Plekhh2 UTSW 17 84557466 missense probably benign 0.00
R5409:Plekhh2 UTSW 17 84586478 critical splice donor site probably null
R5510:Plekhh2 UTSW 17 84566847 missense probably benign
R5557:Plekhh2 UTSW 17 84560152 missense probably benign 0.10
R5684:Plekhh2 UTSW 17 84597918 missense probably damaging 1.00
R5685:Plekhh2 UTSW 17 84569882 missense probably damaging 1.00
R5724:Plekhh2 UTSW 17 84566805 missense probably benign 0.00
R5742:Plekhh2 UTSW 17 84597980 missense probably damaging 1.00
R5817:Plekhh2 UTSW 17 84571726 missense possibly damaging 0.86
R6218:Plekhh2 UTSW 17 84591564 missense probably benign 0.03
R6334:Plekhh2 UTSW 17 84566866 missense probably benign
R6345:Plekhh2 UTSW 17 84575787 missense probably benign 0.01
R6617:Plekhh2 UTSW 17 84566287 missense possibly damaging 0.65
R6755:Plekhh2 UTSW 17 84591585 missense probably damaging 1.00
R6864:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R7171:Plekhh2 UTSW 17 84521788 missense probably damaging 0.96
R7413:Plekhh2 UTSW 17 84566296 missense probably benign 0.03
R7585:Plekhh2 UTSW 17 84577180 missense probably benign 0.11
R7640:Plekhh2 UTSW 17 84610776 missense possibly damaging 0.50
R7733:Plekhh2 UTSW 17 84583524 nonsense probably null
R7877:Plekhh2 UTSW 17 84575006 missense probably benign
R8085:Plekhh2 UTSW 17 84597956 missense probably damaging 0.98
R8206:Plekhh2 UTSW 17 84590849 missense possibly damaging 0.47
R8296:Plekhh2 UTSW 17 84600685 missense probably damaging 0.98
R8344:Plekhh2 UTSW 17 84571761 missense possibly damaging 0.64
R8438:Plekhh2 UTSW 17 84569951 missense probably benign
R8487:Plekhh2 UTSW 17 84557481 missense possibly damaging 0.55
R8708:Plekhh2 UTSW 17 84574993 missense probably benign 0.00
R8830:Plekhh2 UTSW 17 84521803 missense probably damaging 1.00
R8847:Plekhh2 UTSW 17 84571051 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACGGTTCTAGAAATGGCG -3'
(R):5'- ATAATCACCTTCTCCGGGCC -3'

Sequencing Primer
(F):5'- CCACGGTTCTAGAAATGGCGTAAAG -3'
(R):5'- ACCTTCTCCGGGCCTTCTTG -3'
Posted On2015-11-11