Incidental Mutation 'R4757:Trp53bp2'
ID358203
Institutional Source Beutler Lab
Gene Symbol Trp53bp2
Ensembl Gene ENSMUSG00000026510
Gene Nametransformation related protein 53 binding protein 2
Synonyms53BP2, ASPP2
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location182409172-182462432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 182458774 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1060 (M1060L)
Ref Sequence ENSEMBL: ENSMUSP00000112508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117245]
Predicted Effect probably benign
Transcript: ENSMUST00000117245
AA Change: M1060L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112508
Gene: ENSMUSG00000026510
AA Change: M1060L

DomainStartEndE-ValueType
PDB:2UWQ|A 4 89 1e-53 PDB
Blast:RA 10 91 7e-50 BLAST
coiled coil region 129 306 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
low complexity region 495 512 N/A INTRINSIC
PDB:4IRV|H 728 788 5e-25 PDB
low complexity region 865 890 N/A INTRINSIC
ANK 964 993 2.52e-6 SMART
ANK 997 1026 7.13e-6 SMART
SH3 1066 1124 6.2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191804
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation is lethal by 30 days of age, although majority die embryonically. Heterozygotes show increased susceptibility to spontaneous and induced tumors of the lymphoma and sarcoma types [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Trp53bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Trp53bp2 APN 1 182440976 missense probably benign 0.17
IGL00920:Trp53bp2 APN 1 182444654 unclassified probably benign
IGL01336:Trp53bp2 APN 1 182431583 missense probably damaging 1.00
IGL01760:Trp53bp2 APN 1 182448428 missense possibly damaging 0.68
IGL02539:Trp53bp2 APN 1 182448691 missense probably damaging 0.99
IGL02609:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02720:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02962:Trp53bp2 APN 1 182431595 missense probably benign 0.00
IGL03348:Trp53bp2 APN 1 182453748 missense probably damaging 1.00
Nosa UTSW 1 182455740 missense probably damaging 1.00
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0347:Trp53bp2 UTSW 1 182441648 missense probably benign 0.08
R1422:Trp53bp2 UTSW 1 182446464 missense probably benign
R1833:Trp53bp2 UTSW 1 182429016 missense probably damaging 0.98
R1845:Trp53bp2 UTSW 1 182458903 missense probably damaging 1.00
R1893:Trp53bp2 UTSW 1 182431628 missense probably benign 0.01
R1927:Trp53bp2 UTSW 1 182452664 missense probably damaging 0.98
R2017:Trp53bp2 UTSW 1 182449015 missense probably benign
R2020:Trp53bp2 UTSW 1 182442819 missense probably damaging 1.00
R2072:Trp53bp2 UTSW 1 182458867 missense probably benign 0.00
R2120:Trp53bp2 UTSW 1 182441639 missense probably benign 0.06
R2504:Trp53bp2 UTSW 1 182441639 missense probably benign 0.26
R2970:Trp53bp2 UTSW 1 182431598 missense probably damaging 1.00
R3051:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3052:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3053:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3151:Trp53bp2 UTSW 1 182428960 missense probably damaging 1.00
R4043:Trp53bp2 UTSW 1 182449061 missense possibly damaging 0.93
R4785:Trp53bp2 UTSW 1 182448997 missense probably benign
R4817:Trp53bp2 UTSW 1 182441805 critical splice donor site probably null
R4836:Trp53bp2 UTSW 1 182431582 missense probably damaging 1.00
R5040:Trp53bp2 UTSW 1 182444706 missense probably damaging 1.00
R5882:Trp53bp2 UTSW 1 182442212 missense possibly damaging 0.87
R6007:Trp53bp2 UTSW 1 182455740 missense probably damaging 1.00
R6356:Trp53bp2 UTSW 1 182448997 missense probably benign
R6886:Trp53bp2 UTSW 1 182429043 critical splice donor site probably null
R6987:Trp53bp2 UTSW 1 182446635 missense probably damaging 0.99
R7026:Trp53bp2 UTSW 1 182442735 missense probably benign
R7141:Trp53bp2 UTSW 1 182448508 missense
R7363:Trp53bp2 UTSW 1 182444666 missense probably damaging 0.99
R7452:Trp53bp2 UTSW 1 182446568 nonsense probably null
R7816:Trp53bp2 UTSW 1 182448695 missense probably damaging 0.99
R7838:Trp53bp2 UTSW 1 182455819 missense probably damaging 1.00
R7921:Trp53bp2 UTSW 1 182455819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAAACACTGCTGGTCTCCC -3'
(R):5'- CGTCAGCATTGGAGTGACTTAC -3'

Sequencing Primer
(F):5'- CGTTCCCTCCCATGCTGG -3'
(R):5'- AGTGACTTACTCCTAGCAAGTTGCG -3'
Posted On2015-11-11