Incidental Mutation 'R4757:Duoxa2'
ID358209
Institutional Source Beutler Lab
Gene Symbol Duoxa2
Ensembl Gene ENSMUSG00000027225
Gene Namedual oxidase maturation factor 2
Synonyms
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122298900-122302885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122300591 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 78 (V78L)
Ref Sequence ENSEMBL: ENSMUSP00000028656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028653] [ENSMUST00000028656] [ENSMUST00000053734] [ENSMUST00000110537] [ENSMUST00000110538] [ENSMUST00000147788] [ENSMUST00000148417]
Predicted Effect probably benign
Transcript: ENSMUST00000028653
SMART Domains Protein: ENSMUSP00000028653
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 10 287 7.2e-115 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000028656
AA Change: V78L

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225
AA Change: V78L

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053734
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110537
SMART Domains Protein: ENSMUSP00000106166
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 290 3.9e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110538
SMART Domains Protein: ENSMUSP00000106167
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 70 1.7e-23 PFAM
Pfam:DuoxA 67 245 2.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147788
SMART Domains Protein: ENSMUSP00000116280
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 134 5.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148417
SMART Domains Protein: ENSMUSP00000116963
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 210 1.2e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155561
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum protein that is necessary for proper cellular localization and maturation of functional dual oxidase 2. Mutations in this gene have been associated with thyroid dyshormonogenesis 5.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele of Duoxa1 and 2 exhibit severe hypothyrodism with severe postnatal growth, delayed eye opening, enlarged thyroid, enlarged adenohypophysis, respiratory distress and death at weaning when weaned at 21 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Duoxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Duoxa2 APN 2 122300591 missense possibly damaging 0.93
IGL02194:Duoxa2 APN 2 122301849 missense possibly damaging 0.92
R1681:Duoxa2 UTSW 2 122299162 unclassified probably null
R2186:Duoxa2 UTSW 2 122299174 missense probably damaging 1.00
R4062:Duoxa2 UTSW 2 122300577 missense probably damaging 1.00
R4064:Duoxa2 UTSW 2 122300577 missense probably damaging 1.00
R4791:Duoxa2 UTSW 2 122301198 missense probably damaging 1.00
R5485:Duoxa2 UTSW 2 122299152 missense possibly damaging 0.82
R6025:Duoxa2 UTSW 2 122301851 missense possibly damaging 0.92
R7335:Duoxa2 UTSW 2 122301340 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGAATCTGGGAGCTTTGCCG -3'
(R):5'- AGTTCCTACCCACAGGATCTC -3'

Sequencing Primer
(F):5'- GTCTCTCACTAAGTAGCCCAGG -3'
(R):5'- AGGATCTCCTGTCTCCCAC -3'
Posted On2015-11-11