Incidental Mutation 'R4757:Phox2b'
ID358226
Institutional Source Beutler Lab
Gene Symbol Phox2b
Ensembl Gene ENSMUSG00000012520
Gene Namepaired-like homeobox 2b
SynonymsPmx2b, Phox2b, Dilp1, NBPhox, GENA 269
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location67094399-67099301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67098854 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 30 (Y30N)
Ref Sequence ENSEMBL: ENSMUSP00000134216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012664] [ENSMUST00000174251]
Predicted Effect possibly damaging
Transcript: ENSMUST00000012664
AA Change: Y30N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000012664
Gene: ENSMUSG00000012520
AA Change: Y30N

DomainStartEndE-ValueType
HOX 98 160 5.75e-27 SMART
low complexity region 209 279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174251
AA Change: Y30N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134216
Gene: ENSMUSG00000012520
AA Change: Y30N

DomainStartEndE-ValueType
HOX 98 156 1.49e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for an ethylnitrosourea-induced mutation exhibit dilated pupils and reduced preweaning viability. Other mice heterozygous for mutations in this gene exhibit respiratory failure and specific loss of parafacial interneurons. Homozygotes are inviable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Phox2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Phox2b APN 5 67098919 missense probably damaging 1.00
IGL02197:Phox2b APN 5 67096526 unclassified probably benign
IGL02713:Phox2b APN 5 67096595 unclassified probably benign
R0266:Phox2b UTSW 5 67096625 unclassified probably null
R0632:Phox2b UTSW 5 67096214 unclassified probably benign
R3552:Phox2b UTSW 5 67097656 missense probably damaging 0.98
R3706:Phox2b UTSW 5 67096529 unclassified probably benign
R6484:Phox2b UTSW 5 67097701 missense possibly damaging 0.52
R7110:Phox2b UTSW 5 67096162 missense unknown
R7159:Phox2b UTSW 5 67097585 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGGCTTCCTATATACGAGCG -3'
(R):5'- CGTTGAGCAGTGCACATCTC -3'

Sequencing Primer
(F):5'- CTTCCTATATACGAGCGGAAAGGC -3'
(R):5'- GTGCACATCTCCCCACTCCAG -3'
Posted On2015-11-11