Incidental Mutation 'R4757:Olfr653'
ID358242
Institutional Source Beutler Lab
Gene Symbol Olfr653
Ensembl Gene ENSMUSG00000073926
Gene Nameolfactory receptor 653
SynonymsMOR33-1, GA_x6K02T2PBJ9-7206970-7207923
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104577314-104584117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104580197 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 184 (Y184H)
Ref Sequence ENSEMBL: ENSMUSP00000149192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098174] [ENSMUST00000215585] [ENSMUST00000217466]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098174
AA Change: Y184H

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095776
Gene: ENSMUSG00000073926
AA Change: Y184H

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 2.2e-111 PFAM
Pfam:7TM_GPCR_Srsx 41 179 4.6e-10 PFAM
Pfam:7tm_1 47 298 5.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215585
AA Change: Y184H

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217466
AA Change: Y184H

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Olfr653
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Olfr653 APN 7 104579943 missense probably damaging 1.00
I2288:Olfr653 UTSW 7 104580386 missense probably damaging 1.00
PIT4131001:Olfr653 UTSW 7 104580030 missense probably damaging 0.99
R0325:Olfr653 UTSW 7 104580360 missense probably damaging 1.00
R1579:Olfr653 UTSW 7 104580061 nonsense probably null
R1599:Olfr653 UTSW 7 104579648 start codon destroyed probably null
R1956:Olfr653 UTSW 7 104579909 missense probably damaging 1.00
R2134:Olfr653 UTSW 7 104579641 start gained probably benign
R2418:Olfr653 UTSW 7 104579934 missense probably benign 0.00
R2483:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
R3623:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
R4049:Olfr653 UTSW 7 104580368 missense probably benign
R4755:Olfr653 UTSW 7 104580061 nonsense probably null
R4828:Olfr653 UTSW 7 104579973 missense possibly damaging 0.62
R4842:Olfr653 UTSW 7 104580215 missense probably benign 0.45
R5496:Olfr653 UTSW 7 104580494 missense probably damaging 1.00
R6830:Olfr653 UTSW 7 104580240 missense probably damaging 1.00
R7320:Olfr653 UTSW 7 104580438 nonsense probably null
R7590:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
RF020:Olfr653 UTSW 7 104580290 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTGCCACAGAGTCAGCTG -3'
(R):5'- ATGTGCTGAATGCTCGGAAC -3'

Sequencing Primer
(F):5'- ACAGAGTCAGCTGTTCTGC -3'
(R):5'- CTCGGAACTGGGCATCCTTTG -3'
Posted On2015-11-11