Incidental Mutation 'R4757:Ankk1'
ID358251
Institutional Source Beutler Lab
Gene Symbol Ankk1
Ensembl Gene ENSMUSG00000032257
Gene Nameankyrin repeat and kinase domain containing 1
Synonyms9930020N01Rik
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location49415194-49427021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49415930 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 650 (M650L)
Ref Sequence ENSEMBL: ENSMUSP00000034792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034792]
Predicted Effect probably benign
Transcript: ENSMUST00000034792
AA Change: M650L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034792
Gene: ENSMUSG00000032257
AA Change: M650L

DomainStartEndE-ValueType
Pfam:Pkinase 35 298 4.1e-44 PFAM
Pfam:Pkinase_Tyr 36 297 7.6e-47 PFAM
ANK 369 398 1.36e-2 SMART
ANK 402 431 4.13e-2 SMART
ANK 435 464 3.51e-5 SMART
ANK 468 497 5.62e-4 SMART
ANK 501 530 5.71e-5 SMART
ANK 534 563 1.05e-3 SMART
ANK 567 596 1.12e-3 SMART
ANK 600 629 6.12e-5 SMART
ANK 633 662 1.59e-3 SMART
ANK 666 695 3.65e-3 SMART
ANK 699 728 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and protein kinase superfamily involved in signal transduction pathways. This gene is closely linked to DRD2 gene (GeneID:1813) on chr 11, and a well studied restriction fragment length polymorphism (RFLP) designated TaqIA, was originally associated with the DRD2 gene, however, later was determined to be located in exon 8 of ANKK1 gene (PMIDs: 18621654, 15146457), where it causes a nonconservative amino acid substitution. It is not clear if this gene plays any role in neuropsychiatric disorders previously associated with Taq1A RFLP. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Ankk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ankk1 APN 9 49421900 missense probably benign 0.30
IGL00495:Ankk1 APN 9 49415843 missense probably benign 0.00
IGL01316:Ankk1 APN 9 49420484 unclassified probably benign
IGL01359:Ankk1 APN 9 49416028 missense possibly damaging 0.95
IGL01464:Ankk1 APN 9 49415972 missense probably benign 0.26
IGL01719:Ankk1 APN 9 49416781 missense probably benign 0.08
IGL02057:Ankk1 APN 9 49416772 missense probably damaging 1.00
IGL02549:Ankk1 APN 9 49418693 missense probably damaging 1.00
IGL02690:Ankk1 APN 9 49421900 missense probably damaging 0.99
IGL03083:Ankk1 APN 9 49421866 missense probably benign 0.15
IGL03168:Ankk1 APN 9 49415768 missense possibly damaging 0.89
IGL03289:Ankk1 APN 9 49415695 missense probably benign 0.00
R0319:Ankk1 UTSW 9 49416071 missense probably damaging 0.97
R0539:Ankk1 UTSW 9 49418030 missense probably benign
R0827:Ankk1 UTSW 9 49421737 missense possibly damaging 0.81
R1474:Ankk1 UTSW 9 49415839 missense probably damaging 1.00
R1818:Ankk1 UTSW 9 49420425 missense probably benign 0.06
R1851:Ankk1 UTSW 9 49415850 missense probably benign
R2044:Ankk1 UTSW 9 49419364 critical splice donor site probably null
R2088:Ankk1 UTSW 9 49421965 unclassified probably benign
R2353:Ankk1 UTSW 9 49418690 missense probably benign
R2897:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R2898:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R3121:Ankk1 UTSW 9 49426967 missense probably benign 0.21
R3714:Ankk1 UTSW 9 49421713 missense possibly damaging 0.92
R4455:Ankk1 UTSW 9 49418066 missense probably benign 0.00
R4893:Ankk1 UTSW 9 49415683 missense probably benign 0.00
R5090:Ankk1 UTSW 9 49421763 missense probably damaging 0.98
R5521:Ankk1 UTSW 9 49420448 missense probably benign 0.05
R5812:Ankk1 UTSW 9 49426853 missense probably benign 0.00
R5853:Ankk1 UTSW 9 49418695 missense possibly damaging 0.58
R5873:Ankk1 UTSW 9 49415896 missense probably benign 0.19
R6119:Ankk1 UTSW 9 49426883 missense possibly damaging 0.88
R6328:Ankk1 UTSW 9 49416071 missense possibly damaging 0.84
R6606:Ankk1 UTSW 9 49416346 missense probably benign 0.29
R6689:Ankk1 UTSW 9 49420476 missense probably damaging 1.00
R6745:Ankk1 UTSW 9 49416180 missense probably benign 0.00
R6856:Ankk1 UTSW 9 49420020 missense probably benign 0.39
R7424:Ankk1 UTSW 9 49418750 missense possibly damaging 0.93
Z1176:Ankk1 UTSW 9 49416643 missense probably benign 0.01
Z1176:Ankk1 UTSW 9 49421911 missense probably damaging 1.00
Z1177:Ankk1 UTSW 9 49415944 missense probably damaging 0.99
Z1177:Ankk1 UTSW 9 49416487 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCAGCAGCTTTAACTAGAACTTTG -3'
(R):5'- ATATGGAGCCAGCCTTGAGC -3'

Sequencing Primer
(F):5'- GCTTTAACTAGAACTTTGAGGATGGC -3'
(R):5'- GCCTTGAGCTACGCACAC -3'
Posted On2015-11-11