Incidental Mutation 'R4757:Cyb5d1'
ID358260
Institutional Source Beutler Lab
Gene Symbol Cyb5d1
Ensembl Gene ENSMUSG00000044795
Gene Namecytochrome b5 domain containing 1
SynonymsLOC327951
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69391925-69395631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69394988 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 74 (D74G)
Ref Sequence ENSEMBL: ENSMUSP00000104300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050140] [ENSMUST00000051620] [ENSMUST00000094077] [ENSMUST00000108660] [ENSMUST00000144531]
Predicted Effect probably benign
Transcript: ENSMUST00000050140
SMART Domains Protein: ENSMUSP00000055528
Gene: ENSMUSG00000045377

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051620
AA Change: D74G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059709
Gene: ENSMUSG00000044795
AA Change: D74G

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082283
Predicted Effect probably benign
Transcript: ENSMUST00000094077
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108660
AA Change: D74G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104300
Gene: ENSMUSG00000044795
AA Change: D74G

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142126
Predicted Effect probably benign
Transcript: ENSMUST00000144531
SMART Domains Protein: ENSMUSP00000123155
Gene: ENSMUSG00000059278

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Sm 43 114 4.26e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Cyb5d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Cyb5d1 APN 11 69393784 unclassified probably null
IGL01897:Cyb5d1 APN 11 69393761 missense probably benign
IGL02566:Cyb5d1 APN 11 69393768 missense probably benign 0.01
IGL02732:Cyb5d1 APN 11 69393809 splice site probably null
R0025:Cyb5d1 UTSW 11 69394966 splice site probably null
R0760:Cyb5d1 UTSW 11 69395173 missense probably benign
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1907:Cyb5d1 UTSW 11 69394740 missense probably benign 0.32
R2220:Cyb5d1 UTSW 11 69395045 missense probably benign 0.00
R3756:Cyb5d1 UTSW 11 69393832 missense probably damaging 1.00
R4994:Cyb5d1 UTSW 11 69393771 missense probably damaging 1.00
R5509:Cyb5d1 UTSW 11 69393735 unclassified probably null
R7631:Cyb5d1 UTSW 11 69395039 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCTCATGCAACCAGTGAGTG -3'
(R):5'- ACAACCAGCTCGAGGACCTATG -3'

Sequencing Primer
(F):5'- AGTGGATCTATATGCTTGCGAATC -3'
(R):5'- GGGATTTGTTTACAATCTAACACCGC -3'
Posted On2015-11-11