Incidental Mutation 'R4757:Apod'
ID358270
Institutional Source Beutler Lab
Gene Symbol Apod
Ensembl Gene ENSMUSG00000022548
Gene Nameapolipoprotein D
Synonyms
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location31296192-31314808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31303462 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 65 (N65Y)
Ref Sequence ENSEMBL: ENSMUSP00000119827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115230] [ENSMUST00000130560]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023207
Predicted Effect probably damaging
Transcript: ENSMUST00000115230
AA Change: N65Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110885
Gene: ENSMUSG00000022548
AA Change: N65Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin_2 37 182 3.8e-29 PFAM
Pfam:Lipocalin 43 184 2.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130560
AA Change: N65Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119827
Gene: ENSMUSG00000022548
AA Change: N65Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin_2 37 182 3.8e-29 PFAM
Pfam:Lipocalin 43 184 2.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156456
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of high-density lipoprotein (HDL), but is unique in that it shares greater structural similarity to lipocalin than to other members of the apolipoprotein family, and has a wider tissue expression pattern. The encoded protein is involved in lipid metabolism, and ablation of this gene results in defects in triglyceride metabolism. Elevated levels of this gene product have been observed in multiple tissues of Niemann-Pick disease mouse models, as well as in some tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for one null allele display increased sensitivity to reactive oxygen species, impaired motor and spatial learning, and decreased vertical and horizontal activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Apod
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4195:Apod UTSW 16 31297574 missense probably benign 0.39
R4619:Apod UTSW 16 31297393 missense probably benign 0.38
R4620:Apod UTSW 16 31297393 missense probably benign 0.38
R5290:Apod UTSW 16 31311066 missense probably damaging 0.96
R5363:Apod UTSW 16 31311091 missense probably benign 0.00
R5543:Apod UTSW 16 31303533 critical splice acceptor site probably null
R7054:Apod UTSW 16 31311132 missense probably benign
Z1177:Apod UTSW 16 31297520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGTAGGTGCTCAGCAGTG -3'
(R):5'- TCTGGGAATGATGCTGCAGTC -3'

Sequencing Primer
(F):5'- TGGTTAAAGGGAACACATGCATCC -3'
(R):5'- AATGATGCTGCAGTCCATTTGGC -3'
Posted On2015-11-11