Incidental Mutation 'R4757:Stxbp5l'
ID358271
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Namesyntaxin binding protein 5-like
Synonymst2md1, insulin level locus 1, tomosyn-2, T2dm1, A830015P08Rik, LLGL4
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location37114942-37384962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37188634 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 681 (Y681C)
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114780
AA Change: Y681C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: Y681C

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114781
AA Change: Y681C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: Y681C

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114782
AA Change: Y681C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: Y681C

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114787
AA Change: Y681C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: Y681C

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37208100 missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37204578 missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37215979 missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37345092 missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37200592 missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37329895 missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37208205 missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37186654 nonsense probably null
IGL03125:Stxbp5l APN 16 37186721 missense probably benign 0.02
R0058:Stxbp5l UTSW 16 37142374 missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37288308 missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37216078 splice site probably benign
R0454:Stxbp5l UTSW 16 37134284 missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 37129797 critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37208096 missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37204521 missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 37142432 missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37247869 critical splice donor site probably null
R1593:Stxbp5l UTSW 16 37116052 missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37208111 missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37290927 critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37236275 missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37216036 missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 37115667 missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37208186 missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37200642 nonsense probably null
R2918:Stxbp5l UTSW 16 37200642 nonsense probably null
R2935:Stxbp5l UTSW 16 37134189 missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37241346 nonsense probably null
R3694:Stxbp5l UTSW 16 37241346 nonsense probably null
R3695:Stxbp5l UTSW 16 37241346 nonsense probably null
R4133:Stxbp5l UTSW 16 37208119 missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37247880 missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37255884 missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 37134230 missense probably benign 0.18
R5105:Stxbp5l UTSW 16 37142372 missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37186654 missense probably benign 0.19
R5358:Stxbp5l UTSW 16 37174326 missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 37129851 missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37208097 missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 37129815 missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37204448 missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37188629 missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 37134341 missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37323603 missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37210172 missense probably null 0.21
Z1088:Stxbp5l UTSW 16 37204489 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTTGAGTCAGTATTAGCATG -3'
(R):5'- GGGCTTGTTTCCTGACTTTAAAAC -3'

Sequencing Primer
(F):5'- GCATGCATTTGAATGGCATCACAC -3'
(R):5'- AACACTAATCACTGTCTGATCTCC -3'
Posted On2015-11-11