Incidental Mutation 'R4758:Pikfyve'
ID 358282
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4758 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65311674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1925 (D1925E)
Ref Sequence ENSEMBL: ENSMUSP00000079926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
AlphaFold Q9Z1T6
Predicted Effect possibly damaging
Transcript: ENSMUST00000081154
AA Change: D1925E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: D1925E

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097707
AA Change: D1970E

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: D1970E

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,127,754 (GRCm39) Y119N probably damaging Het
Actn2 T A 13: 12,303,472 (GRCm39) K443* probably null Het
Adgrb2 A G 4: 129,903,143 (GRCm39) N581S probably damaging Het
Afg2a T A 3: 37,487,385 (GRCm39) S416T probably benign Het
Alb A T 5: 90,616,452 (GRCm39) H319L probably benign Het
Aox1 A G 1: 58,371,741 (GRCm39) I802V probably benign Het
Arhgap45 G A 10: 79,866,127 (GRCm39) G995E probably benign Het
Capn12 A C 7: 28,592,148 (GRCm39) T689P possibly damaging Het
Cars1 T C 7: 143,125,304 (GRCm39) S312G probably benign Het
Cast T A 13: 74,887,999 (GRCm39) D216V possibly damaging Het
Ccdc13 C T 9: 121,662,800 (GRCm39) E72K possibly damaging Het
Cd300lg G T 11: 101,944,417 (GRCm39) probably null Het
Cep41 A G 6: 30,671,368 (GRCm39) probably benign Het
Chrna3 A G 9: 54,929,560 (GRCm39) Y93H probably damaging Het
Cic A G 7: 24,991,636 (GRCm39) R1309G possibly damaging Het
Clcnkb A G 4: 141,135,160 (GRCm39) V526A probably benign Het
Clec4a1 G T 6: 122,910,825 (GRCm39) V227F probably damaging Het
Cpa5 C A 6: 30,615,159 (GRCm39) H99N possibly damaging Het
Crem C A 18: 3,327,527 (GRCm39) C4F probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Decr2 C A 17: 26,307,914 (GRCm39) E46D probably damaging Het
Dlg1 G A 16: 31,610,570 (GRCm39) V284I possibly damaging Het
Dnah3 T C 7: 119,678,629 (GRCm39) E360G probably benign Het
Dnajc1 A T 2: 18,313,757 (GRCm39) Y121* probably null Het
Dnajc13 A G 9: 104,049,773 (GRCm39) F1783L probably damaging Het
Eps8l2 T A 7: 140,940,286 (GRCm39) D505E probably damaging Het
Eral1 G A 11: 77,966,425 (GRCm39) T251I probably benign Het
Eya3 T C 4: 132,422,196 (GRCm39) probably null Het
Fam120a G A 13: 49,034,333 (GRCm39) T1093I probably benign Het
Fbn2 C T 18: 58,159,458 (GRCm39) A2424T probably benign Het
Git2 G A 5: 114,868,412 (GRCm39) T256M probably damaging Het
Gm9805 A T 17: 22,689,871 (GRCm38) Y34F probably benign Het
Itgb7 T G 15: 102,124,642 (GRCm39) T792P probably benign Het
Jakmip1 T A 5: 37,285,966 (GRCm39) I665N probably damaging Het
Kcnt2 T C 1: 140,446,635 (GRCm39) Y677H probably damaging Het
Klhdc4 G A 8: 122,524,783 (GRCm39) P382S probably benign Het
Knl1 TCC TC 2: 118,902,213 (GRCm39) probably null Het
Lamb3 T A 1: 193,022,269 (GRCm39) M1039K possibly damaging Het
Lipm A T 19: 34,078,570 (GRCm39) M1L possibly damaging Het
Lrrc37 A G 11: 103,505,290 (GRCm39) V2226A possibly damaging Het
Magi3 T A 3: 103,922,637 (GRCm39) D1360V probably benign Het
Mier2 C A 10: 79,386,182 (GRCm39) C23F probably damaging Het
Myo1h C T 5: 114,487,643 (GRCm39) R616C probably damaging Het
Nars2 A G 7: 96,622,735 (GRCm39) D187G probably damaging Het
Nbea T C 3: 55,912,824 (GRCm39) M988V probably benign Het
Nlrc5 C A 8: 95,238,956 (GRCm39) Q1465K possibly damaging Het
Nlrp4e T C 7: 23,020,043 (GRCm39) F177L probably benign Het
Oas1a A G 5: 121,045,401 (GRCm39) F47L probably damaging Het
Oas1f A G 5: 120,985,545 (GRCm39) E30G probably damaging Het
Obscn A T 11: 58,894,189 (GRCm39) M6689K unknown Het
Obscn A T 11: 59,026,743 (GRCm39) D153E probably damaging Het
Or52s6 A C 7: 103,092,076 (GRCm39) C85G probably damaging Het
Osmr A T 15: 6,882,036 (GRCm39) I36K probably benign Het
Pcf11 A T 7: 92,310,383 (GRCm39) F535Y probably damaging Het
Pde2a C T 7: 101,160,706 (GRCm39) R886C probably damaging Het
Pik3ca T A 3: 32,492,127 (GRCm39) C242S probably benign Het
Plekhm2 A T 4: 141,369,316 (GRCm39) Y123N possibly damaging Het
Pomt2 A T 12: 87,169,652 (GRCm39) V406D probably damaging Het
Ppfia2 G C 10: 106,597,978 (GRCm39) L180F probably damaging Het
Prdm10 A T 9: 31,273,708 (GRCm39) T985S probably benign Het
Proc T A 18: 32,256,863 (GRCm39) Y268F probably damaging Het
Prrc1 C T 18: 57,517,320 (GRCm39) T365M probably damaging Het
Rasa1 A T 13: 85,382,567 (GRCm39) D446E probably benign Het
Ribc2 T A 15: 85,025,867 (GRCm39) L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 (GRCm39) D385G probably damaging Het
Sdk2 A G 11: 113,717,880 (GRCm39) S1495P possibly damaging Het
Slc15a3 G T 19: 10,831,726 (GRCm39) probably null Het
Slc43a3 A G 2: 84,774,869 (GRCm39) N149S probably damaging Het
Specc1l A G 10: 75,082,182 (GRCm39) Q543R probably damaging Het
Spef1 T C 2: 131,014,661 (GRCm39) probably null Het
Spns1 A T 7: 125,969,966 (GRCm39) F478Y probably damaging Het
Srebf2 T C 15: 82,080,370 (GRCm39) V821A probably benign Het
Stac3 A G 10: 127,339,214 (GRCm39) M108V possibly damaging Het
Stradb A G 1: 59,027,730 (GRCm39) T87A probably benign Het
Stxbp5l A T 16: 36,954,592 (GRCm39) M906K probably benign Het
Tex14 T C 11: 87,405,311 (GRCm39) V741A probably benign Het
Thoc2l A C 5: 104,668,265 (GRCm39) E929A possibly damaging Het
Tpo C A 12: 30,125,870 (GRCm39) G830C probably damaging Het
Unc79 T A 12: 103,128,080 (GRCm39) C2308* probably null Het
Vmn1r205 T C 13: 22,777,016 (GRCm39) T29A possibly damaging Het
Vmn1r69 G A 7: 10,314,473 (GRCm39) T7I probably benign Het
Vmn2r27 T G 6: 124,208,596 (GRCm39) T50P possibly damaging Het
Wdr83 A G 8: 85,801,867 (GRCm39) Y302H probably benign Het
Xirp2 A T 2: 67,346,879 (GRCm39) E3040V probably damaging Het
Zfp629 C A 7: 127,209,758 (GRCm39) G684W probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATTGTGGCAGTAACTACAAGG -3'
(R):5'- AGATTCTGCTCCAGTGTTAACC -3'

Sequencing Primer
(F):5'- CAGTAACTACAAGGGATCTTTTTGCC -3'
(R):5'- GGCTGACTTACCTATGATGCCAAC -3'
Posted On 2015-11-11