Mutagenetix > Incidental Mutation

Incidental Mutation 'R4758:Kcnt2'

358283

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R4758 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140518897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 677 (Y677H)

Ref Sequence

ENSEMBL: ENSMUSP00000112887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

probably damaging
Transcript: ENSMUST00000119786
AA Change: Y627H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: Y627H

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120709
AA Change: Y677H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: Y677H

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120796
AA Change: Y677H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: Y677H

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145077

SMART Domains

Protein: ENSMUSP00000123677
Gene: ENSMUSG00000052726

Domain	Start	End	E-Value	Type
Pfam:BK_channel_a	1	88	1.2e-23	PFAM
low complexity region	209	224	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000193606
AA Change: Y37H

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	A	3: 36,073,605	Y119N	probably damaging	Het
Actn2	T	A	13: 12,288,586	K443*	probably null	Het
Adgrb2	A	G	4: 130,009,350	N581S	probably damaging	Het
Alb	A	T	5: 90,468,593	H319L	probably benign	Het
Aox2	A	G	1: 58,332,582	I802V	probably benign	Het
Arhgap45	G	A	10: 80,030,293	G995E	probably benign	Het
BC005561	A	C	5: 104,520,399	E929A	possibly damaging	Het
Capn12	A	C	7: 28,892,723	T689P	possibly damaging	Het
Cars	T	C	7: 143,571,567	S312G	probably benign	Het
Cast	T	A	13: 74,739,880	D216V	possibly damaging	Het
Ccdc13	C	T	9: 121,833,734	E72K	possibly damaging	Het
Cd300lg	G	T	11: 102,053,591		probably null	Het
Cep41	A	G	6: 30,671,369		probably benign	Het
Chrna3	A	G	9: 55,022,276	Y93H	probably damaging	Het
Cic	A	G	7: 25,292,211	R1309G	possibly damaging	Het
Clcnkb	A	G	4: 141,407,849	V526A	probably benign	Het
Clec4a1	G	T	6: 122,933,866	V227F	probably damaging	Het
Cpa5	C	A	6: 30,615,160	H99N	possibly damaging	Het
Crem	C	A	18: 3,327,527	C4F	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Decr2	C	A	17: 26,088,940	E46D	probably damaging	Het
Dlg1	G	A	16: 31,791,752	V284I	possibly damaging	Het
Dnah3	T	C	7: 120,079,406	E360G	probably benign	Het
Dnajc1	A	T	2: 18,308,946	Y121*	probably null	Het
Dnajc13	A	G	9: 104,172,574	F1783L	probably damaging	Het
Eps8l2	T	A	7: 141,360,373	D505E	probably damaging	Het
Eral1	G	A	11: 78,075,599	T251I	probably benign	Het
Eya3	T	C	4: 132,694,885		probably null	Het
Fam120a	G	A	13: 48,880,857	T1093I	probably benign	Het
Fbn2	C	T	18: 58,026,386	A2424T	probably benign	Het
Git2	G	A	5: 114,730,351	T256M	probably damaging	Het
Gm884	A	G	11: 103,614,464	V2226A	possibly damaging	Het
Gm9805	A	T	17: 22,689,871	Y34F	probably benign	Het
Itgb7	T	G	15: 102,216,207	T792P	probably benign	Het
Jakmip1	T	A	5: 37,128,622	I665N	probably damaging	Het
Klhdc4	G	A	8: 121,798,044	P382S	probably benign	Het
Knl1	TCC	TC	2: 119,071,732		probably null	Het
Lamb3	T	A	1: 193,339,961	M1039K	possibly damaging	Het
Lipm	A	T	19: 34,101,170	M1L	possibly damaging	Het
Magi3	T	A	3: 104,015,321	D1360V	probably benign	Het
Mier2	C	A	10: 79,550,348	C23F	probably damaging	Het
Myo1h	C	T	5: 114,349,582	R616C	probably damaging	Het
Nars2	A	G	7: 96,973,528	D187G	probably damaging	Het
Nbea	T	C	3: 56,005,403	M988V	probably benign	Het
Nlrc5	C	A	8: 94,512,328	Q1465K	possibly damaging	Het
Nlrp4e	T	C	7: 23,320,618	F177L	probably benign	Het
Oas1a	A	G	5: 120,907,338	F47L	probably damaging	Het
Oas1f	A	G	5: 120,847,480	E30G	probably damaging	Het
Obscn	A	T	11: 59,003,363	M6689K	unknown	Het
Obscn	A	T	11: 59,135,917	D153E	probably damaging	Het
Olfr605	A	C	7: 103,442,869	C85G	probably damaging	Het
Osmr	A	T	15: 6,852,555	I36K	probably benign	Het
Pcf11	A	T	7: 92,661,175	F535Y	probably damaging	Het
Pde2a	C	T	7: 101,511,499	R886C	probably damaging	Het
Pik3ca	T	A	3: 32,437,978	C242S	probably benign	Het
Pikfyve	T	A	1: 65,272,515	D1925E	possibly damaging	Het
Plekhm2	A	T	4: 141,642,005	Y123N	possibly damaging	Het
Pomt2	A	T	12: 87,122,878	V406D	probably damaging	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prdm10	A	T	9: 31,362,412	T985S	probably benign	Het
Proc	T	A	18: 32,123,810	Y268F	probably damaging	Het
Prrc1	C	T	18: 57,384,248	T365M	probably damaging	Het
Rasa1	A	T	13: 85,234,448	D446E	probably benign	Het
Ribc2	T	A	15: 85,141,666	L281Q	probably damaging	Het
Runx1t1	A	G	4: 13,865,907	D385G	probably damaging	Het
Sdk2	A	G	11: 113,827,054	S1495P	possibly damaging	Het
Slc15a3	G	T	19: 10,854,362		probably null	Het
Slc43a3	A	G	2: 84,944,525	N149S	probably damaging	Het
Spata5	T	A	3: 37,433,236	S416T	probably benign	Het
Specc1l	A	G	10: 75,246,348	Q543R	probably damaging	Het
Spef1	T	C	2: 131,172,741		probably null	Het
Spns1	A	T	7: 126,370,794	F478Y	probably damaging	Het
Srebf2	T	C	15: 82,196,169	V821A	probably benign	Het
Stac3	A	G	10: 127,503,345	M108V	possibly damaging	Het
Stradb	A	G	1: 58,988,571	T87A	probably benign	Het
Stxbp5l	A	T	16: 37,134,230	M906K	probably benign	Het
Tex14	T	C	11: 87,514,485	V741A	probably benign	Het
Tpo	C	A	12: 30,075,871	G830C	probably damaging	Het
Unc79	T	A	12: 103,161,821	C2308*	probably null	Het
Vmn1r205	T	C	13: 22,592,846	T29A	possibly damaging	Het
Vmn1r69	G	A	7: 10,580,546	T7I	probably benign	Het
Vmn2r27	T	G	6: 124,231,637	T50P	possibly damaging	Het
Wdr83	A	G	8: 85,075,238	Y302H	probably benign	Het
Xirp2	A	T	2: 67,516,535	E3040V	probably damaging	Het
Zfp629	C	A	7: 127,610,586	G684W	probably damaging	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9232:Kcnt2	UTSW	1	140484193	missense	possibly damaging	0.56
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- ATGCATGCAGAACTGAAAGCTC -3'
(R):5'- AGAGTCTTGTGCCTGTCGTC -3'

Sequencing Primer
(F):5'- GCAGGTCATAATACATTGCAATCTG -3'
(R):5'- CCTAACTGACTGGTTAACATAACTGG -3'

Posted On

2015-11-11