Incidental Mutation 'R4758:Dnajc1'
ID358286
Institutional Source Beutler Lab
Gene Symbol Dnajc1
Ensembl Gene ENSMUSG00000026740
Gene NameDnaJ heat shock protein family (Hsp40) member C1
Synonyms4733401K02Rik, MTJ1, Dnajl1, D230036H06Rik, ERdj1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4758 (G1)
Quality Score205
Status Not validated
Chromosome2
Chromosomal Location18195654-18392830 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 18308946 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 121 (Y121*)
Ref Sequence ENSEMBL: ENSMUSP00000126321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028072] [ENSMUST00000091418] [ENSMUST00000166495]
Predicted Effect probably null
Transcript: ENSMUST00000028072
AA Change: *106R
SMART Domains Protein: ENSMUSP00000028072
Gene: ENSMUSG00000026740
AA Change: *106R

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 104 5.4e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091418
AA Change: Y121*
SMART Domains Protein: ENSMUSP00000088980
Gene: ENSMUSG00000026740
AA Change: Y121*

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153055
Predicted Effect probably null
Transcript: ENSMUST00000163130
AA Change: *79R
SMART Domains Protein: ENSMUSP00000129176
Gene: ENSMUSG00000026740
AA Change: *79R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
DnaJ 34 78 5.4e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164606
Predicted Effect probably benign
Transcript: ENSMUST00000164835
Predicted Effect probably null
Transcript: ENSMUST00000166495
AA Change: Y121*
SMART Domains Protein: ENSMUSP00000126321
Gene: ENSMUSG00000026740
AA Change: Y121*

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168723
SMART Domains Protein: ENSMUSP00000126716
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
SANT 129 180 2.06e-6 SMART
low complexity region 221 239 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
SANT 296 348 3.56e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a DNAJ-like heat shock protein that binds the molecular chaperone BiP. In addition, the encoded protein contains two SANT domains that have been shown to bind serpin alpha1-antichymotrypsin and inter-alpha trypsin inhibitor heavy chain 4. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,073,605 Y119N probably damaging Het
Actn2 T A 13: 12,288,586 K443* probably null Het
Adgrb2 A G 4: 130,009,350 N581S probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Aox2 A G 1: 58,332,582 I802V probably benign Het
Arhgap45 G A 10: 80,030,293 G995E probably benign Het
BC005561 A C 5: 104,520,399 E929A possibly damaging Het
Capn12 A C 7: 28,892,723 T689P possibly damaging Het
Cars T C 7: 143,571,567 S312G probably benign Het
Cast T A 13: 74,739,880 D216V possibly damaging Het
Ccdc13 C T 9: 121,833,734 E72K possibly damaging Het
Cd300lg G T 11: 102,053,591 probably null Het
Cep41 A G 6: 30,671,369 probably benign Het
Chrna3 A G 9: 55,022,276 Y93H probably damaging Het
Cic A G 7: 25,292,211 R1309G possibly damaging Het
Clcnkb A G 4: 141,407,849 V526A probably benign Het
Clec4a1 G T 6: 122,933,866 V227F probably damaging Het
Cpa5 C A 6: 30,615,160 H99N possibly damaging Het
Crem C A 18: 3,327,527 C4F probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Decr2 C A 17: 26,088,940 E46D probably damaging Het
Dlg1 G A 16: 31,791,752 V284I possibly damaging Het
Dnah3 T C 7: 120,079,406 E360G probably benign Het
Dnajc13 A G 9: 104,172,574 F1783L probably damaging Het
Eps8l2 T A 7: 141,360,373 D505E probably damaging Het
Eral1 G A 11: 78,075,599 T251I probably benign Het
Eya3 T C 4: 132,694,885 probably null Het
Fam120a G A 13: 48,880,857 T1093I probably benign Het
Fbn2 C T 18: 58,026,386 A2424T probably benign Het
Git2 G A 5: 114,730,351 T256M probably damaging Het
Gm884 A G 11: 103,614,464 V2226A possibly damaging Het
Gm9805 A T 17: 22,689,871 Y34F probably benign Het
Itgb7 T G 15: 102,216,207 T792P probably benign Het
Jakmip1 T A 5: 37,128,622 I665N probably damaging Het
Kcnt2 T C 1: 140,518,897 Y677H probably damaging Het
Klhdc4 G A 8: 121,798,044 P382S probably benign Het
Knl1 TCC TC 2: 119,071,732 probably null Het
Lamb3 T A 1: 193,339,961 M1039K possibly damaging Het
Lipm A T 19: 34,101,170 M1L possibly damaging Het
Magi3 T A 3: 104,015,321 D1360V probably benign Het
Mier2 C A 10: 79,550,348 C23F probably damaging Het
Myo1h C T 5: 114,349,582 R616C probably damaging Het
Nars2 A G 7: 96,973,528 D187G probably damaging Het
Nbea T C 3: 56,005,403 M988V probably benign Het
Nlrc5 C A 8: 94,512,328 Q1465K possibly damaging Het
Nlrp4e T C 7: 23,320,618 F177L probably benign Het
Oas1a A G 5: 120,907,338 F47L probably damaging Het
Oas1f A G 5: 120,847,480 E30G probably damaging Het
Obscn A T 11: 59,003,363 M6689K unknown Het
Obscn A T 11: 59,135,917 D153E probably damaging Het
Olfr605 A C 7: 103,442,869 C85G probably damaging Het
Osmr A T 15: 6,852,555 I36K probably benign Het
Pcf11 A T 7: 92,661,175 F535Y probably damaging Het
Pde2a C T 7: 101,511,499 R886C probably damaging Het
Pik3ca T A 3: 32,437,978 C242S probably benign Het
Pikfyve T A 1: 65,272,515 D1925E possibly damaging Het
Plekhm2 A T 4: 141,642,005 Y123N possibly damaging Het
Pomt2 A T 12: 87,122,878 V406D probably damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prdm10 A T 9: 31,362,412 T985S probably benign Het
Proc T A 18: 32,123,810 Y268F probably damaging Het
Prrc1 C T 18: 57,384,248 T365M probably damaging Het
Rasa1 A T 13: 85,234,448 D446E probably benign Het
Ribc2 T A 15: 85,141,666 L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 D385G probably damaging Het
Sdk2 A G 11: 113,827,054 S1495P possibly damaging Het
Slc15a3 G T 19: 10,854,362 probably null Het
Slc43a3 A G 2: 84,944,525 N149S probably damaging Het
Spata5 T A 3: 37,433,236 S416T probably benign Het
Specc1l A G 10: 75,246,348 Q543R probably damaging Het
Spef1 T C 2: 131,172,741 probably null Het
Spns1 A T 7: 126,370,794 F478Y probably damaging Het
Srebf2 T C 15: 82,196,169 V821A probably benign Het
Stac3 A G 10: 127,503,345 M108V possibly damaging Het
Stradb A G 1: 58,988,571 T87A probably benign Het
Stxbp5l A T 16: 37,134,230 M906K probably benign Het
Tex14 T C 11: 87,514,485 V741A probably benign Het
Tpo C A 12: 30,075,871 G830C probably damaging Het
Unc79 T A 12: 103,161,821 C2308* probably null Het
Vmn1r205 T C 13: 22,592,846 T29A possibly damaging Het
Vmn1r69 G A 7: 10,580,546 T7I probably benign Het
Vmn2r27 T G 6: 124,231,637 T50P possibly damaging Het
Wdr83 A G 8: 85,075,238 Y302H probably benign Het
Xirp2 A T 2: 67,516,535 E3040V probably damaging Het
Zfp629 C A 7: 127,610,586 G684W probably damaging Het
Other mutations in Dnajc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dnajc1 APN 2 18308902 missense possibly damaging 0.80
IGL01301:Dnajc1 APN 2 18308834 missense probably damaging 0.99
IGL02080:Dnajc1 APN 2 18316348 intron probably benign
IGL03058:Dnajc1 APN 2 18217321 missense possibly damaging 0.90
ANU18:Dnajc1 UTSW 2 18308834 missense probably damaging 0.99
R0537:Dnajc1 UTSW 2 18307956 missense possibly damaging 0.63
R0630:Dnajc1 UTSW 2 18231801 missense probably damaging 1.00
R1187:Dnajc1 UTSW 2 18284709 missense probably benign 0.01
R1511:Dnajc1 UTSW 2 18222727 missense possibly damaging 0.88
R1844:Dnajc1 UTSW 2 18294027 nonsense probably null
R1848:Dnajc1 UTSW 2 18219713 missense probably damaging 1.00
R2174:Dnajc1 UTSW 2 18307951 missense probably damaging 0.99
R2199:Dnajc1 UTSW 2 18308899 missense probably damaging 1.00
R2211:Dnajc1 UTSW 2 18392475 missense probably damaging 0.99
R2471:Dnajc1 UTSW 2 18219816 missense possibly damaging 0.75
R5790:Dnajc1 UTSW 2 18307087 intron probably benign
R5802:Dnajc1 UTSW 2 18284739 missense probably benign 0.41
R5950:Dnajc1 UTSW 2 18306941 intron probably benign
R6049:Dnajc1 UTSW 2 18231700 splice site probably null
R6770:Dnajc1 UTSW 2 18217271 unclassified probably benign
R7242:Dnajc1 UTSW 2 18293972 missense probably benign 0.06
R7462:Dnajc1 UTSW 2 18308899 missense probably damaging 0.99
R7716:Dnajc1 UTSW 2 18219873 missense probably benign 0.00
R7846:Dnajc1 UTSW 2 18219893 missense possibly damaging 0.56
R7929:Dnajc1 UTSW 2 18219893 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCTCCAGTACTCACCAGTTGCT -3'
(R):5'- ACACAGTTGTTAAGTCTATGAGATACA -3'

Sequencing Primer
(F):5'- CACCAGTTGCTTTTCCAGGTAGATG -3'
(R):5'- CTCTGCTACATATGCAGCTAGAG -3'
Posted On2015-11-11