Mutagenetix > Incidental Mutation

Incidental Mutation 'R4758:Pik3ca'

358293

Institutional Source

Beutler Lab

Gene Symbol

Pik3ca

Ensembl Gene

ENSMUSG00000027665

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

Synonyms

caPI3K, 6330412C24Rik, p110alpha

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4758 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32397671-32468486 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32437978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 242 (C242S)

Ref Sequence

ENSEMBL: ENSMUSP00000103878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]

AlphaFold

P42337

Predicted Effect

probably benign
Transcript: ENSMUST00000029201
AA Change: C242S

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: C242S

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108242
AA Change: C120S

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: C120S

Domain	Start	End	E-Value	Type
PI3K_rbd	51	170	5e-47	SMART
PI3K_C2	200	303	2.39e-35	SMART
C2	211	319	3.95e-1	SMART
PI3Ka	396	582	8.35e-99	SMART
Blast:PI3Kc	611	644	1e-11	BLAST
PI3Kc	676	943	8.82e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108243
AA Change: C242S

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: C242S

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	A	3: 36,073,605	Y119N	probably damaging	Het
Actn2	T	A	13: 12,288,586	K443*	probably null	Het
Adgrb2	A	G	4: 130,009,350	N581S	probably damaging	Het
Alb	A	T	5: 90,468,593	H319L	probably benign	Het
Aox2	A	G	1: 58,332,582	I802V	probably benign	Het
Arhgap45	G	A	10: 80,030,293	G995E	probably benign	Het
BC005561	A	C	5: 104,520,399	E929A	possibly damaging	Het
Capn12	A	C	7: 28,892,723	T689P	possibly damaging	Het
Cars	T	C	7: 143,571,567	S312G	probably benign	Het
Cast	T	A	13: 74,739,880	D216V	possibly damaging	Het
Ccdc13	C	T	9: 121,833,734	E72K	possibly damaging	Het
Cd300lg	G	T	11: 102,053,591		probably null	Het
Cep41	A	G	6: 30,671,369		probably benign	Het
Chrna3	A	G	9: 55,022,276	Y93H	probably damaging	Het
Cic	A	G	7: 25,292,211	R1309G	possibly damaging	Het
Clcnkb	A	G	4: 141,407,849	V526A	probably benign	Het
Clec4a1	G	T	6: 122,933,866	V227F	probably damaging	Het
Cpa5	C	A	6: 30,615,160	H99N	possibly damaging	Het
Crem	C	A	18: 3,327,527	C4F	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Decr2	C	A	17: 26,088,940	E46D	probably damaging	Het
Dlg1	G	A	16: 31,791,752	V284I	possibly damaging	Het
Dnah3	T	C	7: 120,079,406	E360G	probably benign	Het
Dnajc1	A	T	2: 18,308,946	Y121*	probably null	Het
Dnajc13	A	G	9: 104,172,574	F1783L	probably damaging	Het
Eps8l2	T	A	7: 141,360,373	D505E	probably damaging	Het
Eral1	G	A	11: 78,075,599	T251I	probably benign	Het
Eya3	T	C	4: 132,694,885		probably null	Het
Fam120a	G	A	13: 48,880,857	T1093I	probably benign	Het
Fbn2	C	T	18: 58,026,386	A2424T	probably benign	Het
Git2	G	A	5: 114,730,351	T256M	probably damaging	Het
Gm884	A	G	11: 103,614,464	V2226A	possibly damaging	Het
Gm9805	A	T	17: 22,689,871	Y34F	probably benign	Het
Itgb7	T	G	15: 102,216,207	T792P	probably benign	Het
Jakmip1	T	A	5: 37,128,622	I665N	probably damaging	Het
Kcnt2	T	C	1: 140,518,897	Y677H	probably damaging	Het
Klhdc4	G	A	8: 121,798,044	P382S	probably benign	Het
Knl1	TCC	TC	2: 119,071,732		probably null	Het
Lamb3	T	A	1: 193,339,961	M1039K	possibly damaging	Het
Lipm	A	T	19: 34,101,170	M1L	possibly damaging	Het
Magi3	T	A	3: 104,015,321	D1360V	probably benign	Het
Mier2	C	A	10: 79,550,348	C23F	probably damaging	Het
Myo1h	C	T	5: 114,349,582	R616C	probably damaging	Het
Nars2	A	G	7: 96,973,528	D187G	probably damaging	Het
Nbea	T	C	3: 56,005,403	M988V	probably benign	Het
Nlrc5	C	A	8: 94,512,328	Q1465K	possibly damaging	Het
Nlrp4e	T	C	7: 23,320,618	F177L	probably benign	Het
Oas1a	A	G	5: 120,907,338	F47L	probably damaging	Het
Oas1f	A	G	5: 120,847,480	E30G	probably damaging	Het
Obscn	A	T	11: 59,003,363	M6689K	unknown	Het
Obscn	A	T	11: 59,135,917	D153E	probably damaging	Het
Olfr605	A	C	7: 103,442,869	C85G	probably damaging	Het
Osmr	A	T	15: 6,852,555	I36K	probably benign	Het
Pcf11	A	T	7: 92,661,175	F535Y	probably damaging	Het
Pde2a	C	T	7: 101,511,499	R886C	probably damaging	Het
Pikfyve	T	A	1: 65,272,515	D1925E	possibly damaging	Het
Plekhm2	A	T	4: 141,642,005	Y123N	possibly damaging	Het
Pomt2	A	T	12: 87,122,878	V406D	probably damaging	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prdm10	A	T	9: 31,362,412	T985S	probably benign	Het
Proc	T	A	18: 32,123,810	Y268F	probably damaging	Het
Prrc1	C	T	18: 57,384,248	T365M	probably damaging	Het
Rasa1	A	T	13: 85,234,448	D446E	probably benign	Het
Ribc2	T	A	15: 85,141,666	L281Q	probably damaging	Het
Runx1t1	A	G	4: 13,865,907	D385G	probably damaging	Het
Sdk2	A	G	11: 113,827,054	S1495P	possibly damaging	Het
Slc15a3	G	T	19: 10,854,362		probably null	Het
Slc43a3	A	G	2: 84,944,525	N149S	probably damaging	Het
Spata5	T	A	3: 37,433,236	S416T	probably benign	Het
Specc1l	A	G	10: 75,246,348	Q543R	probably damaging	Het
Spef1	T	C	2: 131,172,741		probably null	Het
Spns1	A	T	7: 126,370,794	F478Y	probably damaging	Het
Srebf2	T	C	15: 82,196,169	V821A	probably benign	Het
Stac3	A	G	10: 127,503,345	M108V	possibly damaging	Het
Stradb	A	G	1: 58,988,571	T87A	probably benign	Het
Stxbp5l	A	T	16: 37,134,230	M906K	probably benign	Het
Tex14	T	C	11: 87,514,485	V741A	probably benign	Het
Tpo	C	A	12: 30,075,871	G830C	probably damaging	Het
Unc79	T	A	12: 103,161,821	C2308*	probably null	Het
Vmn1r205	T	C	13: 22,592,846	T29A	possibly damaging	Het
Vmn1r69	G	A	7: 10,580,546	T7I	probably benign	Het
Vmn2r27	T	G	6: 124,231,637	T50P	possibly damaging	Het
Wdr83	A	G	8: 85,075,238	Y302H	probably benign	Het
Xirp2	A	T	2: 67,516,535	E3040V	probably damaging	Het
Zfp629	C	A	7: 127,610,586	G684W	probably damaging	Het

Other mutations in Pik3ca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01284:Pik3ca	APN	3	32462584	missense	probably damaging	1.00
IGL01894:Pik3ca	APN	3	32450026	missense	possibly damaging	0.91
IGL03118:Pik3ca	APN	3	32459935	missense	probably damaging	1.00
IGL03184:Pik3ca	APN	3	32439886	missense	probably benign	0.27
IGL03401:Pik3ca	APN	3	32437814	splice site	probably null
Interrupted	UTSW	3	32438062	missense	probably damaging	1.00
Lilfella	UTSW	3	32454420	missense	probably damaging	1.00
Peninsular	UTSW	3	32462821	missense	probably benign	0.38
Severed	UTSW	3	32437927	missense	possibly damaging	0.65
R0084:Pik3ca	UTSW	3	32462788	missense	possibly damaging	0.78
R0116:Pik3ca	UTSW	3	32459945	missense	probably damaging	1.00
R0278:Pik3ca	UTSW	3	32439753	missense	possibly damaging	0.60
R0513:Pik3ca	UTSW	3	32461511	missense	probably damaging	1.00
R0543:Pik3ca	UTSW	3	32450261	critical splice acceptor site	probably null
R0622:Pik3ca	UTSW	3	32436552	missense	probably damaging	1.00
R0630:Pik3ca	UTSW	3	32450027	missense	possibly damaging	0.91
R1193:Pik3ca	UTSW	3	32456093	missense	probably damaging	0.99
R1292:Pik3ca	UTSW	3	32454420	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1869:Pik3ca	UTSW	3	32450350	missense	probably damaging	0.99
R1962:Pik3ca	UTSW	3	32443867	missense	probably benign	0.27
R1969:Pik3ca	UTSW	3	32451754	critical splice acceptor site	probably null
R2006:Pik3ca	UTSW	3	32450057	missense	probably damaging	1.00
R2264:Pik3ca	UTSW	3	32437927	missense	possibly damaging	0.65
R2366:Pik3ca	UTSW	3	32462794	nonsense	probably null
R2680:Pik3ca	UTSW	3	32436548	nonsense	probably null
R2680:Pik3ca	UTSW	3	32443885	missense	probably benign	0.00
R3001:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R3002:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R4303:Pik3ca	UTSW	3	32439935	nonsense	probably null
R4416:Pik3ca	UTSW	3	32461530	missense	probably damaging	0.99
R4822:Pik3ca	UTSW	3	32437982	missense	probably benign	0.04
R4856:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R4886:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R5297:Pik3ca	UTSW	3	32450053	missense	probably damaging	1.00
R5636:Pik3ca	UTSW	3	32461560	missense	probably damaging	1.00
R5663:Pik3ca	UTSW	3	32462779	missense	probably damaging	1.00
R6249:Pik3ca	UTSW	3	32461563	missense	probably damaging	1.00
R6264:Pik3ca	UTSW	3	32440714	critical splice donor site	probably null
R6347:Pik3ca	UTSW	3	32462821	missense	probably benign	0.38
R6538:Pik3ca	UTSW	3	32439704	missense	probably damaging	1.00
R7020:Pik3ca	UTSW	3	32436279	missense	probably damaging	0.97
R7720:Pik3ca	UTSW	3	32436218	missense	probably damaging	1.00
R7864:Pik3ca	UTSW	3	32443613	nonsense	probably null
R8218:Pik3ca	UTSW	3	32437847	missense	possibly damaging	0.74
R8478:Pik3ca	UTSW	3	32451848	missense	probably benign
R9100:Pik3ca	UTSW	3	32460019	missense	probably damaging	1.00
R9169:Pik3ca	UTSW	3	32449606	critical splice donor site	probably null
R9255:Pik3ca	UTSW	3	32442832	critical splice donor site	probably null
R9267:Pik3ca	UTSW	3	32438062	missense	probably damaging	1.00
R9278:Pik3ca	UTSW	3	32454438	missense	probably damaging	1.00
R9501:Pik3ca	UTSW	3	32449913	missense	probably damaging	1.00
R9555:Pik3ca	UTSW	3	32451767	missense	probably damaging	1.00
Z1177:Pik3ca	UTSW	3	32437967	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTTACAGGACAAATCATAGTGG -3'
(R):5'- GTGGTACAAGACTTGGCTGG -3'

Sequencing Primer
(F):5'- AATCATAGTGGTGATTTGGGTAATAG -3'
(R):5'- ACAAGACTTGGCTGGCATTC -3'

Posted On

2015-11-11