Incidental Mutation 'R4758:Spata5'
ID358295
Institutional Source Beutler Lab
Gene Symbol Spata5
Ensembl Gene ENSMUSG00000027722
Gene Namespermatogenesis associated 5
SynonymsC78064, 2510048F20Rik, Spaf
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4758 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location37419896-37579096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37433236 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 416 (S416T)
Ref Sequence ENSEMBL: ENSMUSP00000103747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029277] [ENSMUST00000108112] [ENSMUST00000198968]
Predicted Effect probably benign
Transcript: ENSMUST00000029277
AA Change: S415T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029277
Gene: ENSMUSG00000027722
AA Change: S415T

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 135 2.47e-1 SMART
low complexity region 276 287 N/A INTRINSIC
AAA 385 524 4.96e-21 SMART
Blast:AAA 553 622 9e-21 BLAST
AAA 659 797 2.48e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108112
AA Change: S416T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103747
Gene: ENSMUSG00000027722
AA Change: S416T

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 1.14e0 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 4.96e-21 SMART
Blast:AAA 554 623 9e-21 BLAST
AAA 660 798 2.48e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142199
Predicted Effect probably benign
Transcript: ENSMUST00000198968
AA Change: S416T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143349
Gene: ENSMUSG00000027722
AA Change: S416T

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 8.6e-5 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 8.2e-23 SMART
Blast:AAA 554 623 7e-21 BLAST
AAA 660 798 4e-23 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATPase associated with diverse activities family, whose members are defined by a highly conserved ATPase domain. Members of this family participate in diverse cellular processes that include membrane fusion, DNA replication, microtubule severing, and protein degradation. The protein encoded by this gene has a putative mitochondrial targeting sequence and has been proposed to function in maintenance of mitochondrial function and integrity during mouse spermatogenesis. Allelic variants in this gene have been associated with epilepsy, hearing loss, and mental retardation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,073,605 Y119N probably damaging Het
Actn2 T A 13: 12,288,586 K443* probably null Het
Adgrb2 A G 4: 130,009,350 N581S probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Aox2 A G 1: 58,332,582 I802V probably benign Het
Arhgap45 G A 10: 80,030,293 G995E probably benign Het
BC005561 A C 5: 104,520,399 E929A possibly damaging Het
Capn12 A C 7: 28,892,723 T689P possibly damaging Het
Cars T C 7: 143,571,567 S312G probably benign Het
Cast T A 13: 74,739,880 D216V possibly damaging Het
Ccdc13 C T 9: 121,833,734 E72K possibly damaging Het
Cd300lg G T 11: 102,053,591 probably null Het
Cep41 A G 6: 30,671,369 probably benign Het
Chrna3 A G 9: 55,022,276 Y93H probably damaging Het
Cic A G 7: 25,292,211 R1309G possibly damaging Het
Clcnkb A G 4: 141,407,849 V526A probably benign Het
Clec4a1 G T 6: 122,933,866 V227F probably damaging Het
Cpa5 C A 6: 30,615,160 H99N possibly damaging Het
Crem C A 18: 3,327,527 C4F probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Decr2 C A 17: 26,088,940 E46D probably damaging Het
Dlg1 G A 16: 31,791,752 V284I possibly damaging Het
Dnah3 T C 7: 120,079,406 E360G probably benign Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Dnajc13 A G 9: 104,172,574 F1783L probably damaging Het
Eps8l2 T A 7: 141,360,373 D505E probably damaging Het
Eral1 G A 11: 78,075,599 T251I probably benign Het
Eya3 T C 4: 132,694,885 probably null Het
Fam120a G A 13: 48,880,857 T1093I probably benign Het
Fbn2 C T 18: 58,026,386 A2424T probably benign Het
Git2 G A 5: 114,730,351 T256M probably damaging Het
Gm884 A G 11: 103,614,464 V2226A possibly damaging Het
Gm9805 A T 17: 22,689,871 Y34F probably benign Het
Itgb7 T G 15: 102,216,207 T792P probably benign Het
Jakmip1 T A 5: 37,128,622 I665N probably damaging Het
Kcnt2 T C 1: 140,518,897 Y677H probably damaging Het
Klhdc4 G A 8: 121,798,044 P382S probably benign Het
Knl1 TCC TC 2: 119,071,732 probably null Het
Lamb3 T A 1: 193,339,961 M1039K possibly damaging Het
Lipm A T 19: 34,101,170 M1L possibly damaging Het
Magi3 T A 3: 104,015,321 D1360V probably benign Het
Mier2 C A 10: 79,550,348 C23F probably damaging Het
Myo1h C T 5: 114,349,582 R616C probably damaging Het
Nars2 A G 7: 96,973,528 D187G probably damaging Het
Nbea T C 3: 56,005,403 M988V probably benign Het
Nlrc5 C A 8: 94,512,328 Q1465K possibly damaging Het
Nlrp4e T C 7: 23,320,618 F177L probably benign Het
Oas1a A G 5: 120,907,338 F47L probably damaging Het
Oas1f A G 5: 120,847,480 E30G probably damaging Het
Obscn A T 11: 59,003,363 M6689K unknown Het
Obscn A T 11: 59,135,917 D153E probably damaging Het
Olfr605 A C 7: 103,442,869 C85G probably damaging Het
Osmr A T 15: 6,852,555 I36K probably benign Het
Pcf11 A T 7: 92,661,175 F535Y probably damaging Het
Pde2a C T 7: 101,511,499 R886C probably damaging Het
Pik3ca T A 3: 32,437,978 C242S probably benign Het
Pikfyve T A 1: 65,272,515 D1925E possibly damaging Het
Plekhm2 A T 4: 141,642,005 Y123N possibly damaging Het
Pomt2 A T 12: 87,122,878 V406D probably damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prdm10 A T 9: 31,362,412 T985S probably benign Het
Proc T A 18: 32,123,810 Y268F probably damaging Het
Prrc1 C T 18: 57,384,248 T365M probably damaging Het
Rasa1 A T 13: 85,234,448 D446E probably benign Het
Ribc2 T A 15: 85,141,666 L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 D385G probably damaging Het
Sdk2 A G 11: 113,827,054 S1495P possibly damaging Het
Slc15a3 G T 19: 10,854,362 probably null Het
Slc43a3 A G 2: 84,944,525 N149S probably damaging Het
Specc1l A G 10: 75,246,348 Q543R probably damaging Het
Spef1 T C 2: 131,172,741 probably null Het
Spns1 A T 7: 126,370,794 F478Y probably damaging Het
Srebf2 T C 15: 82,196,169 V821A probably benign Het
Stac3 A G 10: 127,503,345 M108V possibly damaging Het
Stradb A G 1: 58,988,571 T87A probably benign Het
Stxbp5l A T 16: 37,134,230 M906K probably benign Het
Tex14 T C 11: 87,514,485 V741A probably benign Het
Tpo C A 12: 30,075,871 G830C probably damaging Het
Unc79 T A 12: 103,161,821 C2308* probably null Het
Vmn1r205 T C 13: 22,592,846 T29A possibly damaging Het
Vmn1r69 G A 7: 10,580,546 T7I probably benign Het
Vmn2r27 T G 6: 124,231,637 T50P possibly damaging Het
Wdr83 A G 8: 85,075,238 Y302H probably benign Het
Xirp2 A T 2: 67,516,535 E3040V probably damaging Het
Zfp629 C A 7: 127,610,586 G684W probably damaging Het
Other mutations in Spata5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Spata5 APN 3 37451802 missense possibly damaging 0.60
IGL00472:Spata5 APN 3 37436644 missense probably benign
IGL02664:Spata5 APN 3 37436665 missense probably damaging 1.00
IGL02797:Spata5 APN 3 37458316 splice site probably benign
IGL02869:Spata5 APN 3 37464545 missense probably damaging 1.00
IGL02891:Spata5 APN 3 37426192 missense probably damaging 0.97
IGL03065:Spata5 APN 3 37432179 missense possibly damaging 0.75
IGL03121:Spata5 APN 3 37464651 missense probably damaging 1.00
IGL03178:Spata5 APN 3 37578783 missense probably damaging 1.00
R0494:Spata5 UTSW 3 37432163 missense possibly damaging 0.79
R0621:Spata5 UTSW 3 37432029 missense probably benign 0.06
R0908:Spata5 UTSW 3 37431623 splice site probably null
R1773:Spata5 UTSW 3 37439185 missense probably damaging 0.99
R2016:Spata5 UTSW 3 37578762 missense possibly damaging 0.48
R3714:Spata5 UTSW 3 37433209 missense probably benign
R3836:Spata5 UTSW 3 37433643 missense possibly damaging 0.91
R4548:Spata5 UTSW 3 37432027 missense probably benign 0.03
R4695:Spata5 UTSW 3 37458325 missense probably damaging 1.00
R5009:Spata5 UTSW 3 37433277 splice site probably benign
R5839:Spata5 UTSW 3 37464654 missense probably damaging 1.00
R6437:Spata5 UTSW 3 37528198 missense probably damaging 1.00
R7067:Spata5 UTSW 3 37431698 nonsense probably null
R7450:Spata5 UTSW 3 37456785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGGAAGTTGTATGGCAC -3'
(R):5'- TTTAAAGTATGAGGTCTGGCTAAGCAC -3'

Sequencing Primer
(F):5'- ACACTGGAAGTTGTATGGCACTTTAG -3'
(R):5'- GCTAAGCACGTGGGTAAAATCACC -3'
Posted On2015-11-11