Incidental Mutation 'R4758:Nbea'
ID 358296
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
Accession Numbers

Genbank: NM_030595
Essential gene? Essential (E-score: 1.000) question?
Stock # R4758 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 55625195-56183701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56005403 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 988 (M988V)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029374
AA Change: M988V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: M988V

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198315
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,073,605 Y119N probably damaging Het
Actn2 T A 13: 12,288,586 K443* probably null Het
Adgrb2 A G 4: 130,009,350 N581S probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Aox2 A G 1: 58,332,582 I802V probably benign Het
Arhgap45 G A 10: 80,030,293 G995E probably benign Het
BC005561 A C 5: 104,520,399 E929A possibly damaging Het
Capn12 A C 7: 28,892,723 T689P possibly damaging Het
Cars T C 7: 143,571,567 S312G probably benign Het
Cast T A 13: 74,739,880 D216V possibly damaging Het
Ccdc13 C T 9: 121,833,734 E72K possibly damaging Het
Cd300lg G T 11: 102,053,591 probably null Het
Cep41 A G 6: 30,671,369 probably benign Het
Chrna3 A G 9: 55,022,276 Y93H probably damaging Het
Cic A G 7: 25,292,211 R1309G possibly damaging Het
Clcnkb A G 4: 141,407,849 V526A probably benign Het
Clec4a1 G T 6: 122,933,866 V227F probably damaging Het
Cpa5 C A 6: 30,615,160 H99N possibly damaging Het
Crem C A 18: 3,327,527 C4F probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Decr2 C A 17: 26,088,940 E46D probably damaging Het
Dlg1 G A 16: 31,791,752 V284I possibly damaging Het
Dnah3 T C 7: 120,079,406 E360G probably benign Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Dnajc13 A G 9: 104,172,574 F1783L probably damaging Het
Eps8l2 T A 7: 141,360,373 D505E probably damaging Het
Eral1 G A 11: 78,075,599 T251I probably benign Het
Eya3 T C 4: 132,694,885 probably null Het
Fam120a G A 13: 48,880,857 T1093I probably benign Het
Fbn2 C T 18: 58,026,386 A2424T probably benign Het
Git2 G A 5: 114,730,351 T256M probably damaging Het
Gm884 A G 11: 103,614,464 V2226A possibly damaging Het
Gm9805 A T 17: 22,689,871 Y34F probably benign Het
Itgb7 T G 15: 102,216,207 T792P probably benign Het
Jakmip1 T A 5: 37,128,622 I665N probably damaging Het
Kcnt2 T C 1: 140,518,897 Y677H probably damaging Het
Klhdc4 G A 8: 121,798,044 P382S probably benign Het
Knl1 TCC TC 2: 119,071,732 probably null Het
Lamb3 T A 1: 193,339,961 M1039K possibly damaging Het
Lipm A T 19: 34,101,170 M1L possibly damaging Het
Magi3 T A 3: 104,015,321 D1360V probably benign Het
Mier2 C A 10: 79,550,348 C23F probably damaging Het
Myo1h C T 5: 114,349,582 R616C probably damaging Het
Nars2 A G 7: 96,973,528 D187G probably damaging Het
Nlrc5 C A 8: 94,512,328 Q1465K possibly damaging Het
Nlrp4e T C 7: 23,320,618 F177L probably benign Het
Oas1a A G 5: 120,907,338 F47L probably damaging Het
Oas1f A G 5: 120,847,480 E30G probably damaging Het
Obscn A T 11: 59,003,363 M6689K unknown Het
Obscn A T 11: 59,135,917 D153E probably damaging Het
Olfr605 A C 7: 103,442,869 C85G probably damaging Het
Osmr A T 15: 6,852,555 I36K probably benign Het
Pcf11 A T 7: 92,661,175 F535Y probably damaging Het
Pde2a C T 7: 101,511,499 R886C probably damaging Het
Pik3ca T A 3: 32,437,978 C242S probably benign Het
Pikfyve T A 1: 65,272,515 D1925E possibly damaging Het
Plekhm2 A T 4: 141,642,005 Y123N possibly damaging Het
Pomt2 A T 12: 87,122,878 V406D probably damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prdm10 A T 9: 31,362,412 T985S probably benign Het
Proc T A 18: 32,123,810 Y268F probably damaging Het
Prrc1 C T 18: 57,384,248 T365M probably damaging Het
Rasa1 A T 13: 85,234,448 D446E probably benign Het
Ribc2 T A 15: 85,141,666 L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 D385G probably damaging Het
Sdk2 A G 11: 113,827,054 S1495P possibly damaging Het
Slc15a3 G T 19: 10,854,362 probably null Het
Slc43a3 A G 2: 84,944,525 N149S probably damaging Het
Spata5 T A 3: 37,433,236 S416T probably benign Het
Specc1l A G 10: 75,246,348 Q543R probably damaging Het
Spef1 T C 2: 131,172,741 probably null Het
Spns1 A T 7: 126,370,794 F478Y probably damaging Het
Srebf2 T C 15: 82,196,169 V821A probably benign Het
Stac3 A G 10: 127,503,345 M108V possibly damaging Het
Stradb A G 1: 58,988,571 T87A probably benign Het
Stxbp5l A T 16: 37,134,230 M906K probably benign Het
Tex14 T C 11: 87,514,485 V741A probably benign Het
Tpo C A 12: 30,075,871 G830C probably damaging Het
Unc79 T A 12: 103,161,821 C2308* probably null Het
Vmn1r205 T C 13: 22,592,846 T29A possibly damaging Het
Vmn1r69 G A 7: 10,580,546 T7I probably benign Het
Vmn2r27 T G 6: 124,231,637 T50P possibly damaging Het
Wdr83 A G 8: 85,075,238 Y302H probably benign Het
Xirp2 A T 2: 67,516,535 E3040V probably damaging Het
Zfp629 C A 7: 127,610,586 G684W probably damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55628493 missense probably damaging 1.00
IGL00541:Nbea APN 3 55968089 missense probably benign 0.02
IGL00584:Nbea APN 3 56082448 missense probably damaging 0.98
IGL00648:Nbea APN 3 56009260 missense probably damaging 0.98
IGL00785:Nbea APN 3 55955393 missense probably benign
IGL00899:Nbea APN 3 55642845 missense probably benign 0.32
IGL00955:Nbea APN 3 56005472 missense possibly damaging 0.45
IGL01296:Nbea APN 3 56031536 missense probably benign 0.04
IGL01299:Nbea APN 3 55690894 missense probably damaging 1.00
IGL01393:Nbea APN 3 56005308 missense probably benign 0.02
IGL01550:Nbea APN 3 55805248 missense possibly damaging 0.93
IGL02023:Nbea APN 3 55681016 missense probably damaging 1.00
IGL02034:Nbea APN 3 55968156 missense probably damaging 1.00
IGL02061:Nbea APN 3 55717887 missense possibly damaging 0.54
IGL02082:Nbea APN 3 55968167 missense possibly damaging 0.88
IGL02113:Nbea APN 3 55992492 missense probably benign
IGL02188:Nbea APN 3 55983837 missense probably benign 0.00
IGL02319:Nbea APN 3 55985738 missense probably damaging 1.00
IGL02406:Nbea APN 3 56086266 missense probably benign 0.02
IGL02494:Nbea APN 3 55805351 missense probably benign 0.02
IGL02550:Nbea APN 3 56019414 missense probably damaging 0.98
IGL02706:Nbea APN 3 56037278 missense probably damaging 1.00
IGL02718:Nbea APN 3 55632062 nonsense probably null
IGL02822:Nbea APN 3 56019447 missense possibly damaging 0.93
IGL02885:Nbea APN 3 55631986 missense probably benign 0.01
IGL03000:Nbea APN 3 56004627 missense possibly damaging 0.94
IGL03081:Nbea APN 3 56079918 missense probably damaging 1.00
IGL03091:Nbea APN 3 56085304 missense probably damaging 1.00
IGL03368:Nbea APN 3 56079930 missense probably damaging 0.98
Neches UTSW 3 55953034 critical splice donor site probably null
scotland UTSW 3 55626908 missense probably damaging 1.00
Wales UTSW 3 56091119 missense probably damaging 1.00
FR4340:Nbea UTSW 3 56009212 critical splice donor site probably benign
G4846:Nbea UTSW 3 56087497 missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55717869 missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55701527 intron probably benign
R0087:Nbea UTSW 3 56091023 missense possibly damaging 0.92
R0220:Nbea UTSW 3 56005303 missense probably benign 0.30
R0324:Nbea UTSW 3 56057948 critical splice donor site probably null
R0330:Nbea UTSW 3 55642817 missense probably benign 0.27
R0391:Nbea UTSW 3 56037277 missense probably damaging 1.00
R0394:Nbea UTSW 3 56029907 missense probably damaging 1.00
R0419:Nbea UTSW 3 55819294 missense probably benign 0.05
R0503:Nbea UTSW 3 55642836 missense possibly damaging 0.79
R0521:Nbea UTSW 3 56008268 missense probably damaging 1.00
R0595:Nbea UTSW 3 55628496 missense probably benign 0.18
R0894:Nbea UTSW 3 56009340 missense possibly damaging 0.89
R1072:Nbea UTSW 3 56086196 missense possibly damaging 0.94
R1125:Nbea UTSW 3 55857006 nonsense probably null
R1169:Nbea UTSW 3 55968323 missense probably benign 0.00
R1241:Nbea UTSW 3 56058040 missense probably damaging 1.00
R1269:Nbea UTSW 3 56004781 missense probably benign 0.05
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1457:Nbea UTSW 3 56085327 missense probably damaging 1.00
R1482:Nbea UTSW 3 56079993 missense probably damaging 1.00
R1483:Nbea UTSW 3 56002790 missense probably benign 0.25
R1502:Nbea UTSW 3 56004889 missense probably benign 0.03
R1544:Nbea UTSW 3 56058827 missense probably damaging 0.99
R1629:Nbea UTSW 3 56002891 missense possibly damaging 0.52
R1647:Nbea UTSW 3 55630229 missense probably damaging 0.97
R1663:Nbea UTSW 3 55645986 missense possibly damaging 0.95
R1722:Nbea UTSW 3 55665695 missense probably damaging 1.00
R1757:Nbea UTSW 3 55630189 missense possibly damaging 0.83
R1771:Nbea UTSW 3 55934519 missense probably benign 0.00
R1796:Nbea UTSW 3 55643708 missense possibly damaging 0.48
R1844:Nbea UTSW 3 56082436 missense probably damaging 0.97
R1872:Nbea UTSW 3 55642889 missense probably benign 0.12
R1938:Nbea UTSW 3 56085322 missense probably damaging 1.00
R1940:Nbea UTSW 3 55953100 missense possibly damaging 0.78
R2062:Nbea UTSW 3 56086157 splice site probably benign
R2066:Nbea UTSW 3 55968146 missense probably damaging 1.00
R2097:Nbea UTSW 3 55723217 missense probably damaging 0.96
R2181:Nbea UTSW 3 56029939 missense possibly damaging 0.92
R2274:Nbea UTSW 3 55988085 splice site probably null
R2345:Nbea UTSW 3 56085279 missense probably damaging 1.00
R2423:Nbea UTSW 3 56085306 missense probably damaging 1.00
R2434:Nbea UTSW 3 55647460 missense possibly damaging 0.91
R2880:Nbea UTSW 3 55647358 missense probably benign 0.04
R2881:Nbea UTSW 3 55647358 missense probably benign 0.04
R2940:Nbea UTSW 3 55934624 missense probably benign 0.24
R3500:Nbea UTSW 3 55681010 missense possibly damaging 0.88
R3765:Nbea UTSW 3 56005549 missense probably damaging 1.00
R3790:Nbea UTSW 3 56005029 missense probably benign
R3808:Nbea UTSW 3 55717848 missense probably benign 0.02
R3845:Nbea UTSW 3 56086292 splice site probably benign
R4182:Nbea UTSW 3 56008427 missense probably damaging 0.99
R4385:Nbea UTSW 3 56000638 missense possibly damaging 0.77
R4419:Nbea UTSW 3 56009600 missense probably damaging 1.00
R4426:Nbea UTSW 3 56082379 missense probably damaging 0.98
R4451:Nbea UTSW 3 55992332 critical splice donor site probably null
R4456:Nbea UTSW 3 55643784 missense probably benign 0.00
R4604:Nbea UTSW 3 55723648 missense probably benign 0.18
R4687:Nbea UTSW 3 56058065 missense probably damaging 1.00
R4840:Nbea UTSW 3 55710670 missense probably benign 0.37
R4888:Nbea UTSW 3 56005355 missense possibly damaging 0.61
R4954:Nbea UTSW 3 56035958 missense probably damaging 1.00
R4972:Nbea UTSW 3 56085246 missense probably damaging 0.99
R4980:Nbea UTSW 3 55647351 splice site probably null
R4980:Nbea UTSW 3 55953045 missense probably benign 0.00
R5104:Nbea UTSW 3 56079927 missense probably damaging 1.00
R5139:Nbea UTSW 3 55626963 missense possibly damaging 0.90
R5166:Nbea UTSW 3 56019453 missense probably damaging 1.00
R5347:Nbea UTSW 3 56040876 missense probably damaging 1.00
R5350:Nbea UTSW 3 56019424 missense probably damaging 1.00
R5418:Nbea UTSW 3 55645989 missense possibly damaging 0.86
R5586:Nbea UTSW 3 55631971 missense probably benign 0.08
R5627:Nbea UTSW 3 55992345 missense probably damaging 1.00
R5683:Nbea UTSW 3 55628586 missense possibly damaging 0.53
R5765:Nbea UTSW 3 56005298 missense probably benign 0.15
R5853:Nbea UTSW 3 55992401 missense probably damaging 1.00
R5858:Nbea UTSW 3 55953034 critical splice donor site probably null
R5955:Nbea UTSW 3 55680983 missense probably benign 0.00
R5976:Nbea UTSW 3 55853847 missense probably benign 0.30
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6043:Nbea UTSW 3 55786475 missense probably benign 0.32
R6122:Nbea UTSW 3 56029896 missense probably damaging 1.00
R6218:Nbea UTSW 3 55628484 missense probably damaging 0.97
R6331:Nbea UTSW 3 56000616 missense possibly damaging 0.94
R6334:Nbea UTSW 3 56037149 missense probably damaging 1.00
R6393:Nbea UTSW 3 56091119 missense probably damaging 1.00
R6411:Nbea UTSW 3 55805357 missense probably benign 0.01
R6457:Nbea UTSW 3 56000569 missense probably damaging 1.00
R6476:Nbea UTSW 3 56004806 missense probably benign 0.00
R6488:Nbea UTSW 3 55717843 missense probably damaging 0.99
R6700:Nbea UTSW 3 56082448 missense possibly damaging 0.89
R6702:Nbea UTSW 3 56005502 missense probably benign 0.06
R6752:Nbea UTSW 3 55968309 missense probably benign 0.02
R6752:Nbea UTSW 3 56037219 missense probably benign
R6804:Nbea UTSW 3 56087453 missense probably benign 0.37
R6901:Nbea UTSW 3 56019415 missense probably damaging 1.00
R6933:Nbea UTSW 3 55723610 missense possibly damaging 0.63
R7124:Nbea UTSW 3 55992444 missense probably damaging 1.00
R7211:Nbea UTSW 3 56004901 missense probably benign 0.05
R7308:Nbea UTSW 3 56091031 missense probably damaging 1.00
R7405:Nbea UTSW 3 55805266 missense possibly damaging 0.94
R7669:Nbea UTSW 3 55717779 missense probably damaging 1.00
R7762:Nbea UTSW 3 55649705 missense probably damaging 1.00
R7833:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7885:Nbea UTSW 3 55665689 missense probably damaging 0.97
R7935:Nbea UTSW 3 56058665 missense probably damaging 1.00
R8050:Nbea UTSW 3 55987981 missense probably damaging 0.99
R8108:Nbea UTSW 3 55819315 missense probably benign 0.11
R8290:Nbea UTSW 3 56058635 nonsense probably null
R8314:Nbea UTSW 3 56009251 missense probably damaging 0.99
R8321:Nbea UTSW 3 56183097 missense possibly damaging 0.86
R8376:Nbea UTSW 3 55643655 missense possibly damaging 0.79
R8410:Nbea UTSW 3 56037263 missense probably damaging 1.00
R8556:Nbea UTSW 3 55647386 missense probably benign 0.25
R8753:Nbea UTSW 3 55626908 missense probably damaging 1.00
R8844:Nbea UTSW 3 56090994 missense probably damaging 0.97
R8884:Nbea UTSW 3 55805299 missense probably benign 0.00
R8886:Nbea UTSW 3 56058727 missense probably damaging 1.00
R8890:Nbea UTSW 3 56019363 splice site probably benign
R9004:Nbea UTSW 3 56002938 missense probably benign 0.01
R9022:Nbea UTSW 3 55643689 missense possibly damaging 0.79
R9080:Nbea UTSW 3 56005095 nonsense probably null
R9087:Nbea UTSW 3 55642736 critical splice donor site probably null
R9104:Nbea UTSW 3 55955388 missense probably benign
R9165:Nbea UTSW 3 56004868 missense probably benign 0.15
R9219:Nbea UTSW 3 56090972 frame shift probably null
R9221:Nbea UTSW 3 56090972 frame shift probably null
R9222:Nbea UTSW 3 56090972 frame shift probably null
R9260:Nbea UTSW 3 55983812 missense possibly damaging 0.50
R9263:Nbea UTSW 3 56090972 frame shift probably null
R9265:Nbea UTSW 3 56090972 frame shift probably null
R9294:Nbea UTSW 3 56091092 missense probably benign 0.00
R9360:Nbea UTSW 3 56035898 missense possibly damaging 0.96
R9387:Nbea UTSW 3 55991039 missense probably benign 0.12
R9428:Nbea UTSW 3 56090972 frame shift probably null
R9435:Nbea UTSW 3 56035888 missense possibly damaging 0.63
R9507:Nbea UTSW 3 55665590 missense probably damaging 1.00
R9514:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9516:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9674:Nbea UTSW 3 56058762 missense probably damaging 1.00
R9688:Nbea UTSW 3 55649744 missense probably benign 0.42
R9709:Nbea UTSW 3 55786458 nonsense probably null
RF051:Nbea UTSW 3 56009212 critical splice donor site probably benign
X0018:Nbea UTSW 3 56036048 missense probably benign 0.39
Z1088:Nbea UTSW 3 55723163 missense probably benign 0.34
Z1177:Nbea UTSW 3 56031550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCATCAAGCTTTACTTCTGTGGC -3'
(R):5'- ACATGCATGGCACCTCAGTG -3'

Sequencing Primer
(F):5'- GTCAACTAGAAGATCATGCACTTC -3'
(R):5'- GGCACCTCAGTGTCCTCTTCAC -3'
Posted On 2015-11-11