Incidental Mutation 'R4758:Plekhm2'
ID358303
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4758 (G1)
Quality Score181
Status Not validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141642005 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 123 (Y123N)
Ref Sequence ENSEMBL: ENSMUSP00000030751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030751
AA Change: Y123N

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: Y123N

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000084203
AA Change: Y123N

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: Y123N

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141844
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,073,605 Y119N probably damaging Het
Actn2 T A 13: 12,288,586 K443* probably null Het
Adgrb2 A G 4: 130,009,350 N581S probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Aox2 A G 1: 58,332,582 I802V probably benign Het
Arhgap45 G A 10: 80,030,293 G995E probably benign Het
BC005561 A C 5: 104,520,399 E929A possibly damaging Het
Capn12 A C 7: 28,892,723 T689P possibly damaging Het
Cars T C 7: 143,571,567 S312G probably benign Het
Cast T A 13: 74,739,880 D216V possibly damaging Het
Ccdc13 C T 9: 121,833,734 E72K possibly damaging Het
Cd300lg G T 11: 102,053,591 probably null Het
Cep41 A G 6: 30,671,369 probably benign Het
Chrna3 A G 9: 55,022,276 Y93H probably damaging Het
Cic A G 7: 25,292,211 R1309G possibly damaging Het
Clcnkb A G 4: 141,407,849 V526A probably benign Het
Clec4a1 G T 6: 122,933,866 V227F probably damaging Het
Cpa5 C A 6: 30,615,160 H99N possibly damaging Het
Crem C A 18: 3,327,527 C4F probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Decr2 C A 17: 26,088,940 E46D probably damaging Het
Dlg1 G A 16: 31,791,752 V284I possibly damaging Het
Dnah3 T C 7: 120,079,406 E360G probably benign Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Dnajc13 A G 9: 104,172,574 F1783L probably damaging Het
Eps8l2 T A 7: 141,360,373 D505E probably damaging Het
Eral1 G A 11: 78,075,599 T251I probably benign Het
Eya3 T C 4: 132,694,885 probably null Het
Fam120a G A 13: 48,880,857 T1093I probably benign Het
Fbn2 C T 18: 58,026,386 A2424T probably benign Het
Git2 G A 5: 114,730,351 T256M probably damaging Het
Gm884 A G 11: 103,614,464 V2226A possibly damaging Het
Gm9805 A T 17: 22,689,871 Y34F probably benign Het
Itgb7 T G 15: 102,216,207 T792P probably benign Het
Jakmip1 T A 5: 37,128,622 I665N probably damaging Het
Kcnt2 T C 1: 140,518,897 Y677H probably damaging Het
Klhdc4 G A 8: 121,798,044 P382S probably benign Het
Knl1 TCC TC 2: 119,071,732 probably null Het
Lamb3 T A 1: 193,339,961 M1039K possibly damaging Het
Lipm A T 19: 34,101,170 M1L possibly damaging Het
Magi3 T A 3: 104,015,321 D1360V probably benign Het
Mier2 C A 10: 79,550,348 C23F probably damaging Het
Myo1h C T 5: 114,349,582 R616C probably damaging Het
Nars2 A G 7: 96,973,528 D187G probably damaging Het
Nbea T C 3: 56,005,403 M988V probably benign Het
Nlrc5 C A 8: 94,512,328 Q1465K possibly damaging Het
Nlrp4e T C 7: 23,320,618 F177L probably benign Het
Oas1a A G 5: 120,907,338 F47L probably damaging Het
Oas1f A G 5: 120,847,480 E30G probably damaging Het
Obscn A T 11: 59,003,363 M6689K unknown Het
Obscn A T 11: 59,135,917 D153E probably damaging Het
Olfr605 A C 7: 103,442,869 C85G probably damaging Het
Osmr A T 15: 6,852,555 I36K probably benign Het
Pcf11 A T 7: 92,661,175 F535Y probably damaging Het
Pde2a C T 7: 101,511,499 R886C probably damaging Het
Pik3ca T A 3: 32,437,978 C242S probably benign Het
Pikfyve T A 1: 65,272,515 D1925E possibly damaging Het
Pomt2 A T 12: 87,122,878 V406D probably damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prdm10 A T 9: 31,362,412 T985S probably benign Het
Proc T A 18: 32,123,810 Y268F probably damaging Het
Prrc1 C T 18: 57,384,248 T365M probably damaging Het
Rasa1 A T 13: 85,234,448 D446E probably benign Het
Ribc2 T A 15: 85,141,666 L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 D385G probably damaging Het
Sdk2 A G 11: 113,827,054 S1495P possibly damaging Het
Slc15a3 G T 19: 10,854,362 probably null Het
Slc43a3 A G 2: 84,944,525 N149S probably damaging Het
Spata5 T A 3: 37,433,236 S416T probably benign Het
Specc1l A G 10: 75,246,348 Q543R probably damaging Het
Spef1 T C 2: 131,172,741 probably null Het
Spns1 A T 7: 126,370,794 F478Y probably damaging Het
Srebf2 T C 15: 82,196,169 V821A probably benign Het
Stac3 A G 10: 127,503,345 M108V possibly damaging Het
Stradb A G 1: 58,988,571 T87A probably benign Het
Stxbp5l A T 16: 37,134,230 M906K probably benign Het
Tex14 T C 11: 87,514,485 V741A probably benign Het
Tpo C A 12: 30,075,871 G830C probably damaging Het
Unc79 T A 12: 103,161,821 C2308* probably null Het
Vmn1r205 T C 13: 22,592,846 T29A possibly damaging Het
Vmn1r69 G A 7: 10,580,546 T7I probably benign Het
Vmn2r27 T G 6: 124,231,637 T50P possibly damaging Het
Wdr83 A G 8: 85,075,238 Y302H probably benign Het
Xirp2 A T 2: 67,516,535 E3040V probably damaging Het
Zfp629 C A 7: 127,610,586 G684W probably damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7947:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense not run
Z1177:Plekhm2 UTSW 4 141639822 missense not run
Predicted Primers PCR Primer
(F):5'- CAAGGCAGACTCTTCAGAGC -3'
(R):5'- TGGTACACAAGGAAACCTTTGG -3'

Sequencing Primer
(F):5'- AGACTCTTCAGAGCCCGGC -3'
(R):5'- CTTTGGAGTCCCAGGTCAGAAAC -3'
Posted On2015-11-11