Mutagenetix > Incidental Mutations

Incidental Mutation 'R4758:Plekhm2'

358303

Institutional Source

Beutler Lab

Gene Symbol

Plekhm2

Ensembl Gene

ENSMUSG00000028917

Gene Name

pleckstrin homology domain containing, family M (with RUN domain) member 2

Synonyms

2310034J19Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4758 (G1)

Quality Score

181

Status

Not validated

Chromosome

Chromosomal Location

141625734-141664899 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 141642005 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 123 (Y123N)

Ref Sequence

ENSEMBL: ENSMUSP00000030751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030751
AA Change: Y123N

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: Y123N

Domain	Start	End	E-Value	Type
RUN	93	156	3.18e-21	SMART
low complexity region	230	246	N/A	INTRINSIC
low complexity region	295	307	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
low complexity region	485	495	N/A	INTRINSIC
low complexity region	505	538	N/A	INTRINSIC
Blast:PH	596	656	7e-31	BLAST
PH	766	869	2.43e-12	SMART
Blast:PH	879	960	6e-9	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084203
AA Change: Y123N

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: Y123N

Domain	Start	End	E-Value	Type
RUN	93	156	3.18e-21	SMART
low complexity region	250	266	N/A	INTRINSIC
low complexity region	315	327	N/A	INTRINSIC
low complexity region	479	489	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
low complexity region	525	558	N/A	INTRINSIC
Blast:PH	616	676	7e-31	BLAST
PH	786	889	2.43e-12	SMART
Blast:PH	899	980	6e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141844

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	A	3: 36,073,605	Y119N	probably damaging	Het
Actn2	T	A	13: 12,288,586	K443*	probably null	Het
Adgrb2	A	G	4: 130,009,350	N581S	probably damaging	Het
Alb	A	T	5: 90,468,593	H319L	probably benign	Het
Aox2	A	G	1: 58,332,582	I802V	probably benign	Het
Arhgap45	G	A	10: 80,030,293	G995E	probably benign	Het
BC005561	A	C	5: 104,520,399	E929A	possibly damaging	Het
Capn12	A	C	7: 28,892,723	T689P	possibly damaging	Het
Cars	T	C	7: 143,571,567	S312G	probably benign	Het
Cast	T	A	13: 74,739,880	D216V	possibly damaging	Het
Ccdc13	C	T	9: 121,833,734	E72K	possibly damaging	Het
Cd300lg	G	T	11: 102,053,591		probably null	Het
Cep41	A	G	6: 30,671,369		probably benign	Het
Chrna3	A	G	9: 55,022,276	Y93H	probably damaging	Het
Cic	A	G	7: 25,292,211	R1309G	possibly damaging	Het
Clcnkb	A	G	4: 141,407,849	V526A	probably benign	Het
Clec4a1	G	T	6: 122,933,866	V227F	probably damaging	Het
Cpa5	C	A	6: 30,615,160	H99N	possibly damaging	Het
Crem	C	A	18: 3,327,527	C4F	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Decr2	C	A	17: 26,088,940	E46D	probably damaging	Het
Dlg1	G	A	16: 31,791,752	V284I	possibly damaging	Het
Dnah3	T	C	7: 120,079,406	E360G	probably benign	Het
Dnajc1	A	T	2: 18,308,946	Y121*	probably null	Het
Dnajc13	A	G	9: 104,172,574	F1783L	probably damaging	Het
Eps8l2	T	A	7: 141,360,373	D505E	probably damaging	Het
Eral1	G	A	11: 78,075,599	T251I	probably benign	Het
Eya3	T	C	4: 132,694,885		probably null	Het
Fam120a	G	A	13: 48,880,857	T1093I	probably benign	Het
Fbn2	C	T	18: 58,026,386	A2424T	probably benign	Het
Git2	G	A	5: 114,730,351	T256M	probably damaging	Het
Gm884	A	G	11: 103,614,464	V2226A	possibly damaging	Het
Gm9805	A	T	17: 22,689,871	Y34F	probably benign	Het
Itgb7	T	G	15: 102,216,207	T792P	probably benign	Het
Jakmip1	T	A	5: 37,128,622	I665N	probably damaging	Het
Kcnt2	T	C	1: 140,518,897	Y677H	probably damaging	Het
Klhdc4	G	A	8: 121,798,044	P382S	probably benign	Het
Knl1	TCC	TC	2: 119,071,732		probably null	Het
Lamb3	T	A	1: 193,339,961	M1039K	possibly damaging	Het
Lipm	A	T	19: 34,101,170	M1L	possibly damaging	Het
Magi3	T	A	3: 104,015,321	D1360V	probably benign	Het
Mier2	C	A	10: 79,550,348	C23F	probably damaging	Het
Myo1h	C	T	5: 114,349,582	R616C	probably damaging	Het
Nars2	A	G	7: 96,973,528	D187G	probably damaging	Het
Nbea	T	C	3: 56,005,403	M988V	probably benign	Het
Nlrc5	C	A	8: 94,512,328	Q1465K	possibly damaging	Het
Nlrp4e	T	C	7: 23,320,618	F177L	probably benign	Het
Oas1a	A	G	5: 120,907,338	F47L	probably damaging	Het
Oas1f	A	G	5: 120,847,480	E30G	probably damaging	Het
Obscn	A	T	11: 59,003,363	M6689K	unknown	Het
Obscn	A	T	11: 59,135,917	D153E	probably damaging	Het
Olfr605	A	C	7: 103,442,869	C85G	probably damaging	Het
Osmr	A	T	15: 6,852,555	I36K	probably benign	Het
Pcf11	A	T	7: 92,661,175	F535Y	probably damaging	Het
Pde2a	C	T	7: 101,511,499	R886C	probably damaging	Het
Pik3ca	T	A	3: 32,437,978	C242S	probably benign	Het
Pikfyve	T	A	1: 65,272,515	D1925E	possibly damaging	Het
Pomt2	A	T	12: 87,122,878	V406D	probably damaging	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prdm10	A	T	9: 31,362,412	T985S	probably benign	Het
Proc	T	A	18: 32,123,810	Y268F	probably damaging	Het
Prrc1	C	T	18: 57,384,248	T365M	probably damaging	Het
Rasa1	A	T	13: 85,234,448	D446E	probably benign	Het
Ribc2	T	A	15: 85,141,666	L281Q	probably damaging	Het
Runx1t1	A	G	4: 13,865,907	D385G	probably damaging	Het
Sdk2	A	G	11: 113,827,054	S1495P	possibly damaging	Het
Slc15a3	G	T	19: 10,854,362		probably null	Het
Slc43a3	A	G	2: 84,944,525	N149S	probably damaging	Het
Spata5	T	A	3: 37,433,236	S416T	probably benign	Het
Specc1l	A	G	10: 75,246,348	Q543R	probably damaging	Het
Spef1	T	C	2: 131,172,741		probably null	Het
Spns1	A	T	7: 126,370,794	F478Y	probably damaging	Het
Srebf2	T	C	15: 82,196,169	V821A	probably benign	Het
Stac3	A	G	10: 127,503,345	M108V	possibly damaging	Het
Stradb	A	G	1: 58,988,571	T87A	probably benign	Het
Stxbp5l	A	T	16: 37,134,230	M906K	probably benign	Het
Tex14	T	C	11: 87,514,485	V741A	probably benign	Het
Tpo	C	A	12: 30,075,871	G830C	probably damaging	Het
Unc79	T	A	12: 103,161,821	C2308*	probably null	Het
Vmn1r205	T	C	13: 22,592,846	T29A	possibly damaging	Het
Vmn1r69	G	A	7: 10,580,546	T7I	probably benign	Het
Vmn2r27	T	G	6: 124,231,637	T50P	possibly damaging	Het
Wdr83	A	G	8: 85,075,238	Y302H	probably benign	Het
Xirp2	A	T	2: 67,516,535	E3040V	probably damaging	Het
Zfp629	C	A	7: 127,610,586	G684W	probably damaging	Het

Other mutations in Plekhm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Plekhm2	APN	4	141642645	splice site	probably null
IGL01388:Plekhm2	APN	4	141642001	missense	probably damaging	1.00
IGL01392:Plekhm2	APN	4	141642426	missense	probably damaging	0.98
IGL01482:Plekhm2	APN	4	141630029	missense	probably damaging	0.98
IGL01828:Plekhm2	APN	4	141629585	missense	probably benign	0.11
IGL02010:Plekhm2	APN	4	141637419	splice site	probably benign
IGL02075:Plekhm2	APN	4	141628306	missense	probably benign	0.38
IGL02381:Plekhm2	APN	4	141642723	missense	possibly damaging	0.95
IGL02543:Plekhm2	APN	4	141642019	missense	probably benign	0.02
IGL02747:Plekhm2	APN	4	141634272	missense	possibly damaging	0.55
IGL02802:Plekhm2	APN	4	141642524	splice site	probably benign
IGL02828:Plekhm2	APN	4	141629630	missense	probably damaging	1.00
IGL03286:Plekhm2	APN	4	141634347	missense	possibly damaging	0.95
R0008:Plekhm2	UTSW	4	141642393	splice site	probably benign
R0008:Plekhm2	UTSW	4	141642393	splice site	probably benign
R0639:Plekhm2	UTSW	4	141642070	missense	probably damaging	1.00
R0682:Plekhm2	UTSW	4	141628125	missense	probably damaging	0.97
R0968:Plekhm2	UTSW	4	141629932	missense	probably benign	0.01
R1109:Plekhm2	UTSW	4	141627984	missense	probably benign	0.31
R1475:Plekhm2	UTSW	4	141627854	missense	possibly damaging	0.75
R1802:Plekhm2	UTSW	4	141634347	missense	probably benign	0.03
R1813:Plekhm2	UTSW	4	141642439	missense	possibly damaging	0.93
R1844:Plekhm2	UTSW	4	141632374	missense	probably benign
R2261:Plekhm2	UTSW	4	141642732	missense	probably damaging	0.98
R3889:Plekhm2	UTSW	4	141641990	splice site	probably benign
R3922:Plekhm2	UTSW	4	141629532	missense	probably benign	0.01
R4324:Plekhm2	UTSW	4	141631857	missense	possibly damaging	0.86
R4814:Plekhm2	UTSW	4	141627839	missense	probably benign	0.00
R4983:Plekhm2	UTSW	4	141634376	missense	probably damaging	1.00
R5468:Plekhm2	UTSW	4	141628100	missense	probably damaging	1.00
R5691:Plekhm2	UTSW	4	141628289	missense	possibly damaging	0.96
R5877:Plekhm2	UTSW	4	141639693	missense	probably damaging	0.98
R6268:Plekhm2	UTSW	4	141632341	nonsense	probably null
R6367:Plekhm2	UTSW	4	141639705	missense	probably damaging	0.97
R6371:Plekhm2	UTSW	4	141629532	missense	possibly damaging	0.94
R6489:Plekhm2	UTSW	4	141632033	missense	probably damaging	1.00
R7266:Plekhm2	UTSW	4	141642459	missense	possibly damaging	0.91
R7399:Plekhm2	UTSW	4	141634376	missense	probably damaging	1.00
R7573:Plekhm2	UTSW	4	141631347	missense	probably benign	0.02
R7742:Plekhm2	UTSW	4	141627839	missense	probably benign	0.00
R7864:Plekhm2	UTSW	4	141628046	missense	probably damaging	0.96
R7920:Plekhm2	UTSW	4	141632121	missense	probably damaging	1.00
R8417:Plekhm2	UTSW	4	141627825	missense	probably benign	0.04
R8462:Plekhm2	UTSW	4	141639819
R8504:Plekhm2	UTSW	4	141642453	missense	probably damaging	1.00
T0722:Plekhm2	UTSW	4	141631981	small deletion	probably benign
T0975:Plekhm2	UTSW	4	141631981	small deletion	probably benign
X0024:Plekhm2	UTSW	4	141628041	missense	probably damaging	1.00
Z1177:Plekhm2	UTSW	4	141629085	missense	possibly damaging	0.77
Z1177:Plekhm2	UTSW	4	141639822	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- CAAGGCAGACTCTTCAGAGC -3'
(R):5'- TGGTACACAAGGAAACCTTTGG -3'

Sequencing Primer
(F):5'- AGACTCTTCAGAGCCCGGC -3'
(R):5'- CTTTGGAGTCCCAGGTCAGAAAC -3'

Posted On

2015-11-11