Incidental Mutation 'R4758:Oas1a'
ID358310
Institutional Source Beutler Lab
Gene Symbol Oas1a
Ensembl Gene ENSMUSG00000052776
Gene Name2'-5' oligoadenylate synthetase 1A
SynonymsL3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4758 (G1)
Quality Score223
Status Not validated
Chromosome5
Chromosomal Location120896256-120907521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120907338 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 47 (F47L)
Ref Sequence ENSEMBL: ENSMUSP00000079198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080322]
Predicted Effect probably damaging
Transcript: ENSMUST00000080322
AA Change: F47L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079198
Gene: ENSMUSG00000052776
AA Change: F47L

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 9.8e-14 PFAM
Pfam:OAS1_C 164 349 1.9e-87 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,073,605 Y119N probably damaging Het
Actn2 T A 13: 12,288,586 K443* probably null Het
Adgrb2 A G 4: 130,009,350 N581S probably damaging Het
Alb A T 5: 90,468,593 H319L probably benign Het
Aox2 A G 1: 58,332,582 I802V probably benign Het
Arhgap45 G A 10: 80,030,293 G995E probably benign Het
BC005561 A C 5: 104,520,399 E929A possibly damaging Het
Capn12 A C 7: 28,892,723 T689P possibly damaging Het
Cars T C 7: 143,571,567 S312G probably benign Het
Cast T A 13: 74,739,880 D216V possibly damaging Het
Ccdc13 C T 9: 121,833,734 E72K possibly damaging Het
Cd300lg G T 11: 102,053,591 probably null Het
Cep41 A G 6: 30,671,369 probably benign Het
Chrna3 A G 9: 55,022,276 Y93H probably damaging Het
Cic A G 7: 25,292,211 R1309G possibly damaging Het
Clcnkb A G 4: 141,407,849 V526A probably benign Het
Clec4a1 G T 6: 122,933,866 V227F probably damaging Het
Cpa5 C A 6: 30,615,160 H99N possibly damaging Het
Crem C A 18: 3,327,527 C4F probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Decr2 C A 17: 26,088,940 E46D probably damaging Het
Dlg1 G A 16: 31,791,752 V284I possibly damaging Het
Dnah3 T C 7: 120,079,406 E360G probably benign Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Dnajc13 A G 9: 104,172,574 F1783L probably damaging Het
Eps8l2 T A 7: 141,360,373 D505E probably damaging Het
Eral1 G A 11: 78,075,599 T251I probably benign Het
Eya3 T C 4: 132,694,885 probably null Het
Fam120a G A 13: 48,880,857 T1093I probably benign Het
Fbn2 C T 18: 58,026,386 A2424T probably benign Het
Git2 G A 5: 114,730,351 T256M probably damaging Het
Gm884 A G 11: 103,614,464 V2226A possibly damaging Het
Gm9805 A T 17: 22,689,871 Y34F probably benign Het
Itgb7 T G 15: 102,216,207 T792P probably benign Het
Jakmip1 T A 5: 37,128,622 I665N probably damaging Het
Kcnt2 T C 1: 140,518,897 Y677H probably damaging Het
Klhdc4 G A 8: 121,798,044 P382S probably benign Het
Knl1 TCC TC 2: 119,071,732 probably null Het
Lamb3 T A 1: 193,339,961 M1039K possibly damaging Het
Lipm A T 19: 34,101,170 M1L possibly damaging Het
Magi3 T A 3: 104,015,321 D1360V probably benign Het
Mier2 C A 10: 79,550,348 C23F probably damaging Het
Myo1h C T 5: 114,349,582 R616C probably damaging Het
Nars2 A G 7: 96,973,528 D187G probably damaging Het
Nbea T C 3: 56,005,403 M988V probably benign Het
Nlrc5 C A 8: 94,512,328 Q1465K possibly damaging Het
Nlrp4e T C 7: 23,320,618 F177L probably benign Het
Oas1f A G 5: 120,847,480 E30G probably damaging Het
Obscn A T 11: 59,003,363 M6689K unknown Het
Obscn A T 11: 59,135,917 D153E probably damaging Het
Olfr605 A C 7: 103,442,869 C85G probably damaging Het
Osmr A T 15: 6,852,555 I36K probably benign Het
Pcf11 A T 7: 92,661,175 F535Y probably damaging Het
Pde2a C T 7: 101,511,499 R886C probably damaging Het
Pik3ca T A 3: 32,437,978 C242S probably benign Het
Pikfyve T A 1: 65,272,515 D1925E possibly damaging Het
Plekhm2 A T 4: 141,642,005 Y123N possibly damaging Het
Pomt2 A T 12: 87,122,878 V406D probably damaging Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prdm10 A T 9: 31,362,412 T985S probably benign Het
Proc T A 18: 32,123,810 Y268F probably damaging Het
Prrc1 C T 18: 57,384,248 T365M probably damaging Het
Rasa1 A T 13: 85,234,448 D446E probably benign Het
Ribc2 T A 15: 85,141,666 L281Q probably damaging Het
Runx1t1 A G 4: 13,865,907 D385G probably damaging Het
Sdk2 A G 11: 113,827,054 S1495P possibly damaging Het
Slc15a3 G T 19: 10,854,362 probably null Het
Slc43a3 A G 2: 84,944,525 N149S probably damaging Het
Spata5 T A 3: 37,433,236 S416T probably benign Het
Specc1l A G 10: 75,246,348 Q543R probably damaging Het
Spef1 T C 2: 131,172,741 probably null Het
Spns1 A T 7: 126,370,794 F478Y probably damaging Het
Srebf2 T C 15: 82,196,169 V821A probably benign Het
Stac3 A G 10: 127,503,345 M108V possibly damaging Het
Stradb A G 1: 58,988,571 T87A probably benign Het
Stxbp5l A T 16: 37,134,230 M906K probably benign Het
Tex14 T C 11: 87,514,485 V741A probably benign Het
Tpo C A 12: 30,075,871 G830C probably damaging Het
Unc79 T A 12: 103,161,821 C2308* probably null Het
Vmn1r205 T C 13: 22,592,846 T29A possibly damaging Het
Vmn1r69 G A 7: 10,580,546 T7I probably benign Het
Vmn2r27 T G 6: 124,231,637 T50P possibly damaging Het
Wdr83 A G 8: 85,075,238 Y302H probably benign Het
Xirp2 A T 2: 67,516,535 E3040V probably damaging Het
Zfp629 C A 7: 127,610,586 G684W probably damaging Het
Other mutations in Oas1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Oas1a APN 5 120899214 missense probably benign 0.01
IGL02299:Oas1a APN 5 120905692 missense probably benign
IGL02951:Oas1a APN 5 120905664 missense probably damaging 1.00
IGL03112:Oas1a APN 5 120898349 missense possibly damaging 0.95
IGL03230:Oas1a APN 5 120898356 missense probably benign 0.23
IGL03356:Oas1a APN 5 120905845 missense probably damaging 0.99
IGL03379:Oas1a APN 5 120896999 missense possibly damaging 0.70
R0625:Oas1a UTSW 5 120899259 missense probably damaging 1.00
R1279:Oas1a UTSW 5 120897178 critical splice donor site probably null
R1914:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R1915:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R4928:Oas1a UTSW 5 120905724 missense probably benign
R5267:Oas1a UTSW 5 120899221 missense probably benign 0.00
R5442:Oas1a UTSW 5 120897206 missense probably benign 0.00
R5487:Oas1a UTSW 5 120907427 missense probably damaging 1.00
R6853:Oas1a UTSW 5 120907428 missense possibly damaging 0.95
R6880:Oas1a UTSW 5 120901940 missense probably damaging 0.97
R7953:Oas1a UTSW 5 120897017 missense probably benign 0.32
R8043:Oas1a UTSW 5 120897017 missense probably benign 0.32
R8363:Oas1a UTSW 5 120905839 missense probably damaging 1.00
R8738:Oas1a UTSW 5 120901956 missense probably damaging 1.00
R8863:Oas1a UTSW 5 120905880 missense probably damaging 1.00
Z1177:Oas1a UTSW 5 120901895 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCCTTCTCCAAAACAGACGTGG -3'
(R):5'- CCTTCTCGGGAAATGGAAACTG -3'

Sequencing Primer
(F):5'- CCAAAACAGACGTGGGTCCTTG -3'
(R):5'- AAATCTACTTCCCATTTCAGCTAGG -3'
Posted On2015-11-11