Mutagenetix > Incidental Mutations

Incidental Mutation 'R4758:Sdk2'

358348

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R4758 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113827054 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1495 (S1495P)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041627
AA Change: S1495P

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: S1495P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125879

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	A	3: 36,073,605	Y119N	probably damaging	Het
Actn2	T	A	13: 12,288,586	K443*	probably null	Het
Adgrb2	A	G	4: 130,009,350	N581S	probably damaging	Het
Alb	A	T	5: 90,468,593	H319L	probably benign	Het
Aox2	A	G	1: 58,332,582	I802V	probably benign	Het
Arhgap45	G	A	10: 80,030,293	G995E	probably benign	Het
BC005561	A	C	5: 104,520,399	E929A	possibly damaging	Het
Capn12	A	C	7: 28,892,723	T689P	possibly damaging	Het
Cars	T	C	7: 143,571,567	S312G	probably benign	Het
Cast	T	A	13: 74,739,880	D216V	possibly damaging	Het
Ccdc13	C	T	9: 121,833,734	E72K	possibly damaging	Het
Cd300lg	G	T	11: 102,053,591		probably null	Het
Cep41	A	G	6: 30,671,369		probably benign	Het
Chrna3	A	G	9: 55,022,276	Y93H	probably damaging	Het
Cic	A	G	7: 25,292,211	R1309G	possibly damaging	Het
Clcnkb	A	G	4: 141,407,849	V526A	probably benign	Het
Clec4a1	G	T	6: 122,933,866	V227F	probably damaging	Het
Cpa5	C	A	6: 30,615,160	H99N	possibly damaging	Het
Crem	C	A	18: 3,327,527	C4F	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Decr2	C	A	17: 26,088,940	E46D	probably damaging	Het
Dlg1	G	A	16: 31,791,752	V284I	possibly damaging	Het
Dnah3	T	C	7: 120,079,406	E360G	probably benign	Het
Dnajc1	A	T	2: 18,308,946	Y121*	probably null	Het
Dnajc13	A	G	9: 104,172,574	F1783L	probably damaging	Het
Eps8l2	T	A	7: 141,360,373	D505E	probably damaging	Het
Eral1	G	A	11: 78,075,599	T251I	probably benign	Het
Eya3	T	C	4: 132,694,885		probably null	Het
Fam120a	G	A	13: 48,880,857	T1093I	probably benign	Het
Fbn2	C	T	18: 58,026,386	A2424T	probably benign	Het
Git2	G	A	5: 114,730,351	T256M	probably damaging	Het
Gm884	A	G	11: 103,614,464	V2226A	possibly damaging	Het
Gm9805	A	T	17: 22,689,871	Y34F	probably benign	Het
Itgb7	T	G	15: 102,216,207	T792P	probably benign	Het
Jakmip1	T	A	5: 37,128,622	I665N	probably damaging	Het
Kcnt2	T	C	1: 140,518,897	Y677H	probably damaging	Het
Klhdc4	G	A	8: 121,798,044	P382S	probably benign	Het
Knl1	TCC	TC	2: 119,071,732		probably null	Het
Lamb3	T	A	1: 193,339,961	M1039K	possibly damaging	Het
Lipm	A	T	19: 34,101,170	M1L	possibly damaging	Het
Magi3	T	A	3: 104,015,321	D1360V	probably benign	Het
Mier2	C	A	10: 79,550,348	C23F	probably damaging	Het
Myo1h	C	T	5: 114,349,582	R616C	probably damaging	Het
Nars2	A	G	7: 96,973,528	D187G	probably damaging	Het
Nbea	T	C	3: 56,005,403	M988V	probably benign	Het
Nlrc5	C	A	8: 94,512,328	Q1465K	possibly damaging	Het
Nlrp4e	T	C	7: 23,320,618	F177L	probably benign	Het
Oas1a	A	G	5: 120,907,338	F47L	probably damaging	Het
Oas1f	A	G	5: 120,847,480	E30G	probably damaging	Het
Obscn	A	T	11: 59,003,363	M6689K	unknown	Het
Obscn	A	T	11: 59,135,917	D153E	probably damaging	Het
Olfr605	A	C	7: 103,442,869	C85G	probably damaging	Het
Osmr	A	T	15: 6,852,555	I36K	probably benign	Het
Pcf11	A	T	7: 92,661,175	F535Y	probably damaging	Het
Pde2a	C	T	7: 101,511,499	R886C	probably damaging	Het
Pik3ca	T	A	3: 32,437,978	C242S	probably benign	Het
Pikfyve	T	A	1: 65,272,515	D1925E	possibly damaging	Het
Plekhm2	A	T	4: 141,642,005	Y123N	possibly damaging	Het
Pomt2	A	T	12: 87,122,878	V406D	probably damaging	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prdm10	A	T	9: 31,362,412	T985S	probably benign	Het
Proc	T	A	18: 32,123,810	Y268F	probably damaging	Het
Prrc1	C	T	18: 57,384,248	T365M	probably damaging	Het
Rasa1	A	T	13: 85,234,448	D446E	probably benign	Het
Ribc2	T	A	15: 85,141,666	L281Q	probably damaging	Het
Runx1t1	A	G	4: 13,865,907	D385G	probably damaging	Het
Slc15a3	G	T	19: 10,854,362		probably null	Het
Slc43a3	A	G	2: 84,944,525	N149S	probably damaging	Het
Spata5	T	A	3: 37,433,236	S416T	probably benign	Het
Specc1l	A	G	10: 75,246,348	Q543R	probably damaging	Het
Spef1	T	C	2: 131,172,741		probably null	Het
Spns1	A	T	7: 126,370,794	F478Y	probably damaging	Het
Srebf2	T	C	15: 82,196,169	V821A	probably benign	Het
Stac3	A	G	10: 127,503,345	M108V	possibly damaging	Het
Stradb	A	G	1: 58,988,571	T87A	probably benign	Het
Stxbp5l	A	T	16: 37,134,230	M906K	probably benign	Het
Tex14	T	C	11: 87,514,485	V741A	probably benign	Het
Tpo	C	A	12: 30,075,871	G830C	probably damaging	Het
Unc79	T	A	12: 103,161,821	C2308*	probably null	Het
Vmn1r205	T	C	13: 22,592,846	T29A	possibly damaging	Het
Vmn1r69	G	A	7: 10,580,546	T7I	probably benign	Het
Vmn2r27	T	G	6: 124,231,637	T50P	possibly damaging	Het
Wdr83	A	G	8: 85,075,238	Y302H	probably benign	Het
Xirp2	A	T	2: 67,516,535	E3040V	probably damaging	Het
Zfp629	C	A	7: 127,610,586	G684W	probably damaging	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTCTGGCCTGGAGGTAGACAG -3'
(R):5'- TGACAGCATGGGTCTTGAG -3'

Sequencing Primer
(F):5'- CCTGGAGGTAGACAGGCCTAG -3'
(R):5'- CACAGTCATAGAGGTTTCAGCCTG -3'

Posted On

2015-11-11